Labshake search
Citations for Qiagen :
501 - 550 of 1254 citations for Protease Inhibitor Cocktail EDTA Free 100X in DMSO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... we performed on-column DNA digestion using RNase-free DNAse (Qiagen) as specified by the kit ...
-
bioRxiv - Cell Biology 2024Quote: ... The Endo-free plasmid maxi kit (#12162, Qiagen, Valencia, CA, USA) was used for plasmid purification.
-
bioRxiv - Microbiology 2024Quote: ... The DNA-free RNA was concentrated by MinElute Cleanup kit (Qiagen). The rRNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... The purified RNA was ultimately resuspended in RNase-Free Water (QIAGEN), and its concentration was determined at 260 nm using a NanoDrop ND-1000 spectrophotometer ...
-
bioRxiv - Cancer Biology 2024Quote: ... on-column DNase treatment was applied using RNase-free DNase (Qiagen). For library preparation ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM EDTA (pH 7.5) and purified on a Genomic-tip 100/G (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were co-transfected at DIV 19 with 10nM of a miR-499-5p or control pLNA inhibitor (miRCURY LNA miRNA-499-5p Power Inhibitor: miR-499-5p or Neg Control A, QIAGEN). After 72h of expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR-324 inhibitors (hsa-miR-324-5p and hsa-miR-324-3p miRCURY LNA miRNA Inhibitor) were obtained from QIAGEN. The sequences of synthetic siRNAs and miRNAs are listed in Supplementary Table S1.
-
bioRxiv - Cancer Biology 2022Quote: ... miR-24-3p LNA inhibitor treatment: Cells were transfected with hsa-miR-24-3p miRCURY LNA miRNA Power Inhibitor (Qiagen, Germantown ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... and pLNAs (miRCURY LNA miRNA Power Inhibitors; QIAGEN) using the Lipofectamine 2000 reagent (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... The following inhibitors were used (purchased from Qiagen): hsa-miR-663b miRCURY LNA miRNA Inhibitor (YI04100013) ...
-
bioRxiv - Microbiology 2019Quote: ... 9 mL 1M Tris HCl pH 7.5, 9 mL 0.5M EDTA pH 8.0, 11.25 mL 10% SDS, 22.5 mL Qiagen lysis reagent ...
-
bioRxiv - Plant Biology 2020Quote: ... whereas adherent mucilage was extracted by shaking seeds in EDTA with the TissueLyser II (Qiagen) at 20 movements/s for 20 min ...
-
bioRxiv - Cell Biology 2021Quote: Genomic DNA was isolated from EDTA blood using the DNeasy Blood & Tissue Kits from QIAGEN SA (Courtaboeuf ...
-
bioRxiv - Microbiology 2020Quote: ... An additional on-column DNAse treatment step (RNAse free DNAse set, Qiagen) was added to remove possible traces of remaining DNA co-extracted with the RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... including on-column DNase treatment using a RNase-free DNase kit (Qiagen). Libraries were made using the NEBNext Ultra Directional RNA library prep kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... Possible genomic DNA contamination was removed by RNase-Free DNase Set (QIAGEN) with the RNeasy columns ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was removed by DNase digestion (Qiagen RNase-Free DNase I Set), then in the same column the RNA was concentrated to 15 µL using the MN NucleoSpin RNA Clean-up XS (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2022Quote: ... according to manufacturer instructions using the RNase-free DNAse Set kit (Qiagen). RNA concentration was measured with a DS-11 UV Spectrophotometer (Denovix) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL was centrifuged and washed twice with nuclease-free water (Qiagen). The cell pellet was resuspended in 500 µL of nuclease-free water ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmid constructs were purified with the Endo-free Plasmid Maxiprep kit (Qiagen). The 140-nt repair template ssODN1 5’-GATTAAGACGATGTTGGAATATGCTGACAAGGTTTTCACTTACATTTTCATT CTGGAAATGCTTCTAACATGGGTGGCATATGGATATCAAACATATTTCACC AATGCCTGGTGTTGGCTGGACTTCTTAATTGTTGATG-3’ (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Endotoxin-free plasmid DNA isolation kits were purchased from Qiagen (cat. 12362). Agarose ...
-
bioRxiv - Neuroscience 2019Quote: ... Circular DNA donor plasmids were purified with an endotoxin-free kit (Qiagen).
-
bioRxiv - Neuroscience 2020Quote: ... RNase-free DNAse I and RNeasy purification columns were purchased from Qiagen Inc ...
-
bioRxiv - Plant Biology 2020Quote: ... An on-column DNaseI digestion with RNase-Free DNase (QIAGEN, Hilden, Germany), was performed according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... All DNA constructs were prepared using Endotoxin-free Maxi Prep kits (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... DNase treatment was performed using RNase-Free DNase Set (Qiagen; Cat#: 79254) to remove residual DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... with on-column DNase digestion (RNase-Free DNase Set, Qiagen, Hilden, Germany). 4 ug of RNA were then used for cDNA preparation using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... with an on-column DNA digestion step (RNase-Free DNase Set; Qiagen). A total of 20 RNA-Seq libraries (one per individual ...
-
bioRxiv - Microbiology 2021Quote: ... the RNA sample was treated with RNase-free DNase I solution (Qiagen), twice ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and genomic DNA was digested using the RNase-Free DNase Set (Qiagen). The RNA integrity number (RIN ...
-
bioRxiv - Microbiology 2020Quote: ... An on-column DNase digestion with the RNase-free DNase Set (Qiagen) was performed to remove genomic DNA contamination in RNA samples.
-
bioRxiv - Microbiology 2021Quote: ... RNA was DNase treated using RNase-Free DNase Set (Qiagen, Hilden, Germany) and purified using RNeasy® MinElute® Cleanup Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... DNAse treatment was performed with RNAse-free DNAse Set (Qiagen, ref: 79254). Equal volumes of all samples were reverse transcribed with Superscript IV reverse transcriptase (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... with in-column DNAse treatment using RNAase-Free DNase (Qiagen, Cat.No.79254). Sequencing libraries were prepared using SMARTer Stranded Total RNA-seq kit (Clontech Laboratories ...
-
bioRxiv - Plant Biology 2021Quote: ... after on column digestion with RNase-free DNase (Qiagen, Cat No. 79256) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... including an on-column DNAse treatment using RNase-free DNase set (Qiagen) to remove genomic DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... with on-column DNase digestion (RNase-Free DNase Set, Qiagen, Hilden, Germany). Quality of the purified RNA was tested on an Agilent 2200 Tapestation using RNA screentape.
-
bioRxiv - Cancer Biology 2020Quote: ... with on-column DNase digestion (RNase-Free DNase Set, Qiagen, Hilden, Germany). cDNA was prepared from 4 μg RNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... DNase treatment was performed immediately after total RNA purification (RNase-free; Qiagen). First strand cDNA was prepared from 400 ng of total RNA and the complementary DNA strand was synthesized using iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Physiology 2022Quote: ... the RNA samples were treated with DNAse RNAse-free (Qiagen, Hilden, Germany) and purified with Rneasy mini column (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was purified with the Endo-Free Mega prep kit (Qiagen) and sequenced by NGS using the approach described in Konermann et al35 ...
-
bioRxiv - Plant Biology 2021Quote: ... and genomic DNA was removed by treating RNase-free DNase I (Qiagen). Extracted RNA was reverse-transcribed using oligo dT and SuperScript™ IV reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... an on-column DNase digestion with the RNase-free DNase set (Qiagen) was performed during total RNA isolation 62 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Residual DNA has been digested with the RNase-Free DNase Set (Qiagen); the abundant ribosomal RNA was depleted by using the Ribo-Zero rRNA Removal Kit (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: ... and genomic DNA was digested with RNase-free DNase set (Qiagen, 79254). miRNA reverse transcription was performed using miRCURY LNA reverse transcription kit (Qiagen ...
-
bioRxiv - Physiology 2021Quote: ... followed by digestion with on column-RNase-free DNAse digestion kit (Qiagen) and clean up with RNeasy mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA was digested with DNase I (RNase-Free DNase Set, Qiagen). Concentration and purity of RNA were both evaluated with NanoDrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 µg RNA was DNase treated using RNase-Free DNase Set (Qiagen). 1 µg of DNase treated RNA was then taken for cDNA synthesis using the Protoscript I first strand cDNA synthesis kit (New England Biolabs) ...