Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Physiology 2019Quote: ... DNA was extracted from 5 µL of RBCs using the Gentra Puregene Tissue Kit (Qiagen) and kept frozen at −80°C until analysis ...
-
bioRxiv - Neuroscience 2020Quote: ... Powdered tissue (∼5 mg) was dissolved in lysis buffer provided by RNeasy micro kit (Qiagen), supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 5 × 106 cells using Qiagen DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen, Germany). Both inserts and vector were eluted and stored in 10 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from 5 million cells using RNeasy Plus Universal Kits (Qiagen, #73404) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA purified from 5-dpf embryos with the miRNeasy Mini Kit (Qiagen, catalog #: 217004). Using this cDNA library ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Microbiology 2021Quote: Whole lung and nasal turbinate tissues were homogenized in PBS with TissueRuptor (Qiagen, Hilden, Germany). A part of the homogenate was centrifuged for 2 min at 2,310 × g to pellet tissue debris and the supernatant was subjected to plaque assays using Vero-TMPRSS2 cells for virus titration as previously described [18] ...
-
bioRxiv - Physiology 2019Quote: Whole tissue RNA was extracted from frozen ileum sections by homogenizing with Tissue Lyzer (QIAGEN) and TRIzol reagent (Life Technologies) ...
-
bioRxiv - Bioengineering 2023Quote: Crushed whole abdominal aortic segments were immersed in RLT lysis buffer (Qiagen N.V., Venlo, Netherlands) and vortexed ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA of whole tissue was extracted using QIAGEN Genomic-tip 100/G (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... with tissue homogenization being performed using a rotor stator type tissue homogenizer (ProScientific Bio-Gen PRO200 Homogenizer; Multi-Gen 7XL Generator Probes) in RLT Buffer (Qiagen). RNA quality was assayed using a nanodrop ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from Cac-P4.5 cells (originating from the PtP4.5 selection plate) using the MagAttract HMW DNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Worms were washed from each plates and genomic DNA was extracted using Qiagen DNeasy Blood & Tissue Kit (Qiagen) and quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: CYP124 was crystallized using a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were collected again using filter plates and subjected to DNeasy 96 Blood and Tissue Kit (Qiagen 69581) (yielding 4-15μg per strain).
-
bioRxiv - Synthetic Biology 2023Quote: Genomic DNA was isolated from Streptomyces plates or liquid cultures using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germany). The bead beating was performed using a TissueLyser LT (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from individual wells of 24-well culture plates using a RNeasy Plus Mini Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: Supernatants from QFT and TruC tubes were analyzed for IFNγ by standard ELISA (Qiagen) and values were expressed in IU/mL ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from whole flash frozen stellate ganglia was isolated using a RNeasy minikit (Qiagen, US) and immediately stored on dry ice before cDNA library preparation ...
-
bioRxiv - Microbiology 2019Quote: Whole blood (10 μL) was collected in an RNase free Eppendorf tube containing lysis buffer (QIAGEN) and stored at −80°C until use ...
-
bioRxiv - Cancer Biology 2020Quote: Whole bone marrow cells were subjected to red blood cell (RBC) lysis (RBC lysis solution, Qiagen) and resuspended in IMDM media containing 10% FBS and 1% penicillin-streptomycin ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole flies were homogenized in PBS + 0.05% Triton-X 100 using a tissuelyser II from Qiagen Glycogen ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: ... 1mL of whole blood was collected directly in QFT Gold tubes (Nil, TB Antigens, Mitogen) (Qiagen) according to manufacturers’ instructions ...
-
bioRxiv - Microbiology 2022Quote: ... core genome based whole genome phylogeny and tree visualization were performed on CLC Genomic workbench (Qiagen) and iTOL v6 (iTOL ...
-
bioRxiv - Microbiology 2023Quote: ... whole eyes were homogenized in PBS using a TissueLyser II (Qiagen, 30 Hz for 3 minutes), and homogenates were serially diluted and streaked on LB plates for quantification of colony forming units (CFU ...
-
bioRxiv - Immunology 2019Quote: ... the inserted coding regions of each gene were transferred to the multi-cloning site of expression vector pQE30 (Qiagen, Hilden, Germany) for the expression of a hexahistidine-tagged protein in E ...
-
bioRxiv - Immunology 2020Quote: Ni-NTA plates (Qiagen) were loaded with 2 μg/mL of SARS-CoV-2 S protein in TBS for 2 h at RT ...