Labshake search
Citations for Qiagen :
201 - 250 of 5358 citations for Primary Human Melanocyte Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and human islets were isolated using RNeasy Mini or Micro kits (Qiagen; Valencia, CA). Reverse transcription was completed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... rodent tissues and human samples using the Qiagen Blood and Tissue Kit (Qiagen, USA). The procedures prior to protein digestion were as follows ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA was extracted from cultured human ECs using a RNeasy Mini kit (Qiagen). For reverse transcription ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from human islets using the miRNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total cellular RNA was isolated from three independent hippocampal primary cultures using RNeasy Mini Kit (Qiagen) according to the manufacturer’s procedure ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA from macrophages or primary tumors was extracted using an RNeasy Mini kit (#74104, Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from primary dissociated cortical neuron cultures using RNeasy Mini Kits (QIAGEN 74104). cDNA was synthesized by reverse transcription using All-In-One 5X RT Master Mix (ABM-G592 ...
-
bioRxiv - Neuroscience 2023Quote: In vitro samples: RNA isolation from primary hippocampal neurons using RNeasy plus micro kit (Qiagen, #74034), according to the manufacturer’s recommendations.
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from primary microglia or astrocyte using the RNeasy Plus Mini kit (Qiagen). The cDNA was subsequently synthesized with an Invitrogen SuperScript® IV First-Strand Synthesis System ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were used at the following dilutions: 1:1000 anti-penta-His mouse monoclonal (Qiagen), 1:5000 anti-cMyc mouse monoclonal (Sigma) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from 3D cultures of mouse primary keratinocytes using RNeasy Micro Kit (QIAGEN, UK), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Neuroscience 2022Quote: RNA purification from both IPSC and primary mouse cortical cultures were done using RNeasy 96 Kit (Qiagen) according to the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using miRCURY LNA miRNA Human Panel I according to manufacturer’s instructions (Exiqon/Qiagen). The data was analyzed using GenEX software (MultiD ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Microbiology 2021Quote: ... while rodent and human samples were eluted in 100 µl of buffer AE (Qiagen, Hilden, Germany). Samples were stored at −20°C before PCR.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from murine and human monocytes with the RNeasy Plus Micro Kit (Qiagen), and then 200 ng of RNA was reverse transcribed using the iScript RT Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Targets were included if biochemically confirmed using human tissue or non-species methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human induced astrocytes (>day 30 of differentiation) were harvested in RLTplus Lysis buffer (Qiagen, 1053393). Total RNA was isolated using the RNeasy micro/mini plus kit (Qiagen ...