Labshake search
Citations for Qiagen :
1 - 50 of 723 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Biochemistry 2022Quote: ... and HRP–conjugated anti Penta-His antibody (Qiagen). Other chemicals used in this study were of an analytical grade or higher ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
Single-cell assessment of trophoblast stem cell-based organoids as human placenta-modeling platformsbioRxiv - Developmental Biology 2022Quote: ... The methylation status of each CpG of interest (n=6 per sample) was evaluated with PyroMark Q-CpG software (Qiagen) and data from all CpG sites was averaged for each sample and presented as percent methylation (Figure S1E).
-
bioRxiv - Microbiology 2020Quote: ... and RotorGene Q (Qiagen)-OneStep RT-PCR (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... 1X Q-Solution (Qiagen), 200 µM dNTP (Qiagen) ...
-
bioRxiv - Genetics 2024Quote: ... 1X Q-Solution (Qiagen), 200 µM dNTP (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... on Rotorgene Q (Qiagen) and analysed via ΔΔ CT against a housekeeping gene as previously described (69) ...
-
bioRxiv - Biophysics 2020Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used.
-
bioRxiv - Biochemistry 2022Quote: ... anti-His antibodies from the Penta-His HRP Conjugate Kit (Qiagen) were used ...
-
bioRxiv - Microbiology 2020Quote: ... An anti·His antibody conjugated to horseradish peroxidase (Penta·His HRP Conjugate, Qiagen) was used to detect 6xHis-tagged proteins ...
-
bioRxiv - Biochemistry 2024Quote: ... A Western blot on nitrocellulose using a PentaHis Antibody HRP conjugate (Qiagen) produced a positive result for the band identified as NONO ...
-
bioRxiv - Microbiology 2021Quote: ... and Rotor-Gene Q (Qiagen). Primers used for qPCR are listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... A Rotor Gene Q (Qiagen) was used with 2x QuantiNova SYBR.
-
bioRxiv - Molecular Biology 2021Quote: ... on Rotor-Gene Q (Qiagen) real-time PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... and Rotor-Gene Q (Qiagen). Thermal cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... Q-solution (1x from QIAGEN), 0.2 mM of dNTPs (DGel electrosystem ...
-
bioRxiv - Neuroscience 2023Quote: ... and Roto-Gene Q (Qiagen). The probes used are listed in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2020Quote: ... q-PCR was performed using a Rotor-Gene Q Real-time PCR machine (Qiagen, Hilden, Germany). The oligonucleotides used in PCR were Kdm2b forward ...
-
bioRxiv - Microbiology 2021Quote: ... in the Rotor-Gene Q (Qiagen) as described previously (van Doremalen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3.5 μL of Q-solution (Qiagen), 1.5 μL of RNase-free water (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... on a Rotor-Gene Q (Qiagen) instrument with a 2-step program (45 cycles of denaturation at 95°C for 15 sec ...
-
bioRxiv - Genomics 2020Quote: ... on a Rotor-Gene Q (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... in the Rotor-Gene Q (QIAGEN) as described previously (13) ...
-
bioRxiv - Immunology 2020Quote: ... on a Rotor-Gene Q (Qiagen) or LightCycler 96 (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 10µl 5x Q-solution (Qiagen). Primers used for the respective vectors are listed in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... in the Rotor-Gene Q (Qiagen). The purity of RNA samples was controlled by running RT controls in each experiment ...
-
bioRxiv - Microbiology 2021Quote: ... in the Rotor-Gene Q (QIAGEN) as described previously 68 ...
-
bioRxiv - Developmental Biology 2022Quote: ... on a Rotor-Gene Q (Qiagen) always comparing enrichments over input samples.
-
bioRxiv - Immunology 2022Quote: ... in the Rotor-Gene Q (Qiagen). Forward primer CCTTGCCTTCCGATATGAATTT ...
-
bioRxiv - Microbiology 2022Quote: ... on the Rotor-Gene Q (Qiagen). RNA from the SUDV stock was extracted the same way and used alongside samples as standards with known TCID50 concentrations ...
-
bioRxiv - Biophysics 2024Quote: ... using the Rotor-Gene Q (Qiagen). Lastly ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Rotor-Gene Q (Qiagen) PCR cycler ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a Rotor-Gene Q (Qiagen) cycler ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a Rotor-Gene Q (Qiagen), as previously described (Carucci et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... on a Rotor-Gene Q (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... on a Rotor-Gene Q (Qiagen) always comparing enrichments over input samples.
-
bioRxiv - Biochemistry 2024Quote: ... on a Rotor-Gene Q (Qiagen). Primers were added and PCR reaction conditions were chosen according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and a Rotor-Gene Q (Qiagen) RT-qPCR machine for cycling ...
-
bioRxiv - Zoology 2024Quote: ... 2 µl 5x Q-Solution (QIAGEN), 1 µl primer mix (2 µM each primer) ...
-
bioRxiv - Systems Biology 2024Quote: ... in a Rotor-Gene Q (Qiagen) under previously reported conditions (20) ...
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Cell Biology 2024Quote: ... The amplification was carried out with the Rotor-Gene Q 6plex System (Rotor-Gene Q, Qiagen, Germany) through 40 cycles ...
-
bioRxiv - Genomics 2024Quote: ... The last kit used was the QiAgen QIAmp® DNA kit (hereafter referred as QiAgen, Q and Q’), which is designed for the recovery of regular weight DNA and uses silica columns for DNA purification ...
-
bioRxiv - Developmental Biology 2021Quote: ... and a Rotor-Gene-Q instrument (QIAGEN). The fold-change in target expression between WT and KO mice was calculated using the 2−ΔΔCt method21 ...
-
bioRxiv - Developmental Biology 2021Quote: ... including the optional Q Buffer solution (Qiagen).
-
Genomic approach for conservation and the sustainable management of endangered species of the AmazonbioRxiv - Genomics 2020Quote: ... using 5.0 μL 2X Qiagen Multiplex PCR Master Mix (Qiagen),S 1.0 μL of Q-Solution (Qiagen), 2.0 μL of H2O ...