Labshake search
Citations for Qiagen :
551 - 600 of 675 citations for PI 3 Kinase p110 delta Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Genomics 2023Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cell lines in 3 biological replicates after each CRISPR/Cas9 oncogene downregulation using QIAzol (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumours were harvested 2-3 weeks after transplantation and genomic DNA was extracted from tumours using the Gentra Puregene DNA Extraction kit (QIAGEN).
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Microbiology 2023Quote: ... tissues were placed in 300μL of sterile PBS containing sterile glass beads and mechanically lysed at a frequency of 20 shakes per seconds for 3 minutes in a TissueLyser II (Qiagen). Negative controls consisted of tubes containing PBS and beads but no sample ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, PR-Set720 and Parp1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genetics 2023Quote: Total RNA was isolated from 10 third-instar larvae for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured on a glass substrate and soft hydrogel for 3 days and total RNA was extracted using RNeasy mini kit (Qiagen). RNA quantity and purity were verified using 2200 TapeStation system (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was isolated from ipsilateral and contralateral ventral midbrain hemispheres at 3 months after AAV-GFP or AAV-Cre-GFP injections using the DNeasy Blood and Tissue kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were homogenized in 500 μl ice-cold 1X Phosphate Buffered Saline buffer with two ice-cold steel bearing balls (3 mm diameter, LOUDET) using a TissueLyser II (Qiagen) and clarified through centrifugation ...
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 50 nM double-stranded siRNA oligonucleotides (Supplementary Table 3) using HiPerFect Transfection Reagent (Qiagen, Crawley, UK).
-
bioRxiv - Immunology 2021Quote: ARNO siRNA (Mm_Pscd2_3) or a negative non-specific siRNA control (Allstar siRNA) were transfected into SFs using HiPerFect transfection reagent (all Qiagen,UK) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Genomics 2022Quote: ... genomic DNA was extracted from 3-week-old leaves of ALO seedling using the QIAGEN® Genomic DNA Extraction Kit (Cat. 13323, Qiagen) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 3-5 million cells were then harvested and genomic DNA was isolated using QIAamp DNA mini kit (QIAGEN, prod. number 51304). The following L1 recovery steps were adapted from24,52 with modifications ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... Synthesis of cDNA was performed on 0.3-1.0 μg of normalized total RNA from each sample using QuantiTect Reverse Transcription kit (Cat No. 205313, Qiagen, Valencia, CA) which included a DNase treatment step to remove any residual genomic DNA contamination ...
-
bioRxiv - Genomics 2021Quote: ... DNA corresponding to the size of mononucleosomes (100-200 bp) was re-isolated from a 3% agarose gel using MinElute Gel Extraction Kit (Qiagen, # 28604). As input ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Approximately half the volume of each feces sample (100-200 mg) was immersed in 3 ml of Inhibit EX Buffer (QIAGEN, Hilden) and stored at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primers were used to assess the relative level of GAT-3 mRNA: Slc6a11 Rn.10545 in comparison to that of cyclophilin A (Peptidylprolyl isomerase A) used as housekeeping gene (Qiagen, UK). Real-time-PCR was performed on the CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Plant Biology 2020Quote: ... by shaking with two 3-mm glass beads for 2 min at 30 Hz with a Tissue-Lyser (Qiagen, Hilden, Germany). After 5 min in an ice-cold ultrasonic bath ...
-
bioRxiv - Systems Biology 2020Quote: RNA was isolated from 3 biological replicates of each U2OS time point according to manufacture instruction using the RNeasy Plus Mini Kit (QIAGEN, #74134). Isolated RNA was reversely transcribed by using first-strand cDNA synthesis kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR was performed in an Applied Biosystems QuantStudio 3 thermocycler using the QuantiNova Probe SYBR Green PCR Kit (Qiagen, Germany); mix proportions and cycling parameters were used as described in manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The lysate was then clarified by centrifugation at 16,000 x g for 45 minutes and then applied to 3 mL Ni-NTA resin (Qiagen, Valencia, CA) equilibrated with buffer A ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: 1-3 million of feeder-independent mESCs were harvested for genomic DNA extraction by using a QIAamp DNA Mini Kit (QIAGEN, 51306). Genomic DNA concentration was determined with a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μl of media from each of 6 plant wells or media from 3 minimal media wells were pooled and stabilized in RNAprotect® Bacteria Reagent (QIAGEN) before performing RNA extraction using RNeasy Mini Kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA was purified after 3 days from the second transfection using the RNeasy Plus Mini Kit (Qiagen, Catalog number 74134) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells from 3 independent biological replicates of MG1655 in each modified medium were treated with RNA protect bacteria reagent (Qiagen, Germany), to prevent degradation of RNA ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Epidemiology 2020Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA was extracted from the stool of enrolled mice (3 mice per group) using the QIAamp DNA Stool Mini kit (Qiagen, Germany). The extracted DNA was amplified using primers targeting the V1 to V3 hypervariable regions of bacterial 16S rRNA gene (27F ...
-
bioRxiv - Immunology 2019Quote: Total RNA yields from the PBMC and stimulated PBMCs were in the range of 3 micrograms (50-100 ng/μl in 30μl Qiagen EB buffer) determined by absorbance at 260nm on the NanoDropTM One (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from aerial parts of 3-week-old seedlings grown on soil using either RNeasy Plant Mini Kit (Qiagen, 74904) or Monarch Total RNA Miniprep Kit (NEB ...