Labshake search
Citations for Qiagen :
1 - 50 of 4495 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Cell Biology 2019Quote: ... We then extracted RNA from the membrane strip by following manufacturer’s manual of the RNA extraction kit (RNeasy kit, cat# 74104, Qiagen) by adding 100ul of RLT+ β-mercapto-ethanol ...
-
bioRxiv - Immunology 2020Quote: SARS-CoV-2 ELISA was developed in-house using His tagged proteins bound on Ni-NTA HisSorb Strips or Plates (Qiagen). ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus ...
-
bioRxiv - Molecular Biology 2021Quote: ... to Rotor-Gene strip reaction tubes (Starlab, 22143, Hamburg, Germany) and RT-qPCR analysis was performed using the Rotor-Gene Q device (Qiagen, 40724, Hilden, Germany). RNase free H2O (Merck-Millipore ...
-
bioRxiv - Genetics 2023Quote: ... PCR product was purified by PCR QIAquick PCR Purification Kit (QIAGEN) and subjected to MiSeq (Center for Computational and Integrative Biology DNA Core ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR products (PCR purification kit, Qiagen) of CHPV and JEV positive samples were sent for sequencing ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification (Qiagen, Taq PCR Core Kit) was used to create more copies with a T7 promoter that was added to the 5’ end of the forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR purified (QIAquick PCR Purification kit, QIAGEN), and used in T7 reverse transcription reactions (MEGAscript ...
-
bioRxiv - Microbiology 2023Quote: ... PCR purification (Qiagen QIAquick PCR Purification Kit) was used to isolate the linearized PCR product ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The PCR products were purified using the PCR QIAquick PCR cleanup kit (Qiagen, 28106) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Purification of PCR products was done using PCR QIAquick PCR cleanup kit (Qiagen, 28106), according to product instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Animal genotyping PCR (Taq PCR Master Mix, Qiagen) samples were run on either 0.8% or 2.0% agarose gels ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified (Qiagen PCR purification Kit) and eluted in 50 μl of 0.1 M NaHCO3 solution ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified (Qiagen PCR purification kit) and assembled with pMV306hyg that was linearized by digestion with NcoI using HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Cell Biology 2019Quote: RT-PCR or PCR products were cleaned up with QIAquick PCR purification kit (28106, QIAGEN) or QIAquick Gel Extraction kit (28706 ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was followed by PCR purification using a QIAquick PCR Purification kit and protocol (Qiagen). About 50 ng of cleaned PCR product of either DENV2 or ZIKV was separately cloned into a TOPO-TA PCR cloning vector (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and a DNA Engine Opticon System (GRI) ...
-
bioRxiv - Microbiology 2020Quote: PCR products obtained by above RT-PCR were purified by QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were purified using PCR purification (Qiagen), followed by restriction enzyme digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
bioRxiv - Plant Biology 2020Quote: ... 2.0 μL of PCR buffer (Qiagen 10x PCR Buffer), 1.0 μL of DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified QIAquick PCR Purification Kit (Qiagen) and cloned into the pCRII-TOPO-TA vector (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified using PCR purification kit (Qiagen) and digested with restriction enzyme KpnI-HF (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was cleaned (Qiagen MinElute PCR Purification Kit) and resuspended in water at a desired concentration of 1-2 ug/uL as measured by a Qubit 3.0 dsDNA assay (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR samples were amplified using PyroMark PCR kit (Qiagen). PCR products were sequenced using PyroMark Q48 Advanced CpG reagents on a PyroMark Q48 Autoprep instrument (Qiagen) ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... After PCR cleanup with QIAquick PCR Purification Kit (Qiagen), the PCR product was digested with NotI at 37°C for 4 hrs and repurified with a QIAquick PCR Purification Kit ...
-
bioRxiv - Genomics 2019Quote: ... PCR purification was performed using PCR Purification kit (Qiagen). DNA was methylated in vitro using M.SssI methyltransferase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was performed with the PyroMark PCR Kit (QIAGEN) using 100 ng / μL of DNA according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... PCR products were purified by PCR-cleanup Kit (Qiagen) and sent for Sanger Sequencing (Genewiz) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... PCR products were purified (MinElute PCR kit – Qiagen #28004) and used as template in a transcription reaction to incorporate DIG-labeled nucleotides into an RNA probe (Thermo Fisher MEGAscript T3 Transcription Reaction Kit) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were purified (QIAquick PCR purification kit; QIAGEN) and TOPO-cloned into dual promoter empty vector (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... The purified PCR product (Qiaquick PCR purification kit, Qiagen) was sequenced using the forward primer (Genewiz ...
-
bioRxiv - Physiology 2023Quote: ... The PCR products were purified (Qiagen PCR purification kit) and assembled using the flanking primers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit) the following day ...
-
bioRxiv - Cancer Biology 2024Quote: ... quantified by digital PCR (QIAcuity Digital PCR system, Qiagen) at the Biofidelity R&D facility (Cambridge ...
-
bioRxiv - Genomics 2019Quote: Two step PCR Each PCR reaction included 25.0 μl of 2X buffer (MultiPlex PCR Master Mix, Qiagen). One microliter each of the 10 pmol forward and reverse primers (Select MultiGEN Diagnostics ...
-
bioRxiv - Molecular Biology 2019Quote: ... Several rounds of PCR amplification with the PCR Primer Cocktail and PCR Master Mix (Qiagen, Duesseldorf, Germany) were performed to enrich the adapter-ligated DNA fragments ...
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: Q-PCR reactions using miRCURY LNA SYBR Green PCR Kit and miRCURY LNA miRNA PCR Assay (Qiagen) were prepared in 384 multi-well plates ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA standards for PCR were generated by purifying PCR-product (MinE-lute PCR Purification Kit, Qiagen, Germany) and 10-fold serial dilution.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with MinElute PCR purification kit (Qiagen) according to manufacturer’s protocol and eluted in 16 µl of elution buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR products were purified with QIAquick PCR purification kit (Qiagen), ligated to Topo Blunt vector (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... PCR products were purified using the PCR purification Kit (Qiagen) according to the instructions by the manufacturer and sent for Sanger sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were purified using MinElute PCR purification kit (Qiagen). Libraries were sequenced using Illumina NextSeq 75 cycle kit with paired-end reads ...
-
bioRxiv - Genomics 2020Quote: ... the PCR products were purified (QIAquick PCR Purification kit, Qiagen), multiplexed ...
-
bioRxiv - Genomics 2020Quote: Quantitative reverse transcription-PCR (qRT-PCR; Rotor-Gene Q; Qiagen) was performed to check the specificity of cDNA products derived from Cap-Seq library preparation ...
-
bioRxiv - Microbiology 2019Quote: PCRs were individually purified using Qiaquick PCR purification kit (Qiagen). The purified products were then analyzed by electrophoresis in 1% precast agarose gels (Sigma).
-
bioRxiv - Genetics 2019Quote: ... PCR products were purified with QIAquick PCR Purification Kit (Qiagen). Amplicons were tagged using NEB Next Ultra II DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified using QIAquick PCR purification kit (Qiagen). The products of restriction enzyme digests were purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: ... After concentrating PCR products using a PCR purification kit (Qiagen) they were digested with PacI and AscI and ligated into the BC library vector that had been treated with PacI ...