Labshake search
Citations for Qiagen :
1 - 50 of 4770 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... The SWIM plates were purified (Qiagen, PCR Purification Kit) and processed to make an Illumina sequencing library ...
-
bioRxiv - Neuroscience 2022Quote: ... and loaded on RT2 PCR profiler plates (Qiagen, PAHS-078Z). Results were analyzed using the GeneGlobe Data Analysis Center (Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in 384-well pick&mix plates (Qiagen) with customized selection of 192 LNA-enhance primers to detect 187 endogenous microRNAs and 5 spike-in controls per sample ...
-
bioRxiv - Cancer Biology 2019Quote: ... and was run on miScript miRNA PCR Array Human Ovarian Cancer plates (Qiagen, MIHS-110ZE-4, 384 well plate). PCR plates were read the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified using 96-well PCR array analysis on a PAMM-150ZA plate (Cytokines & Chemokines) and PAMM-016ZA plate (Type I Interferon Response) (both Qiagen). Quantitative real time-PCR (QRT-PCR ...
-
bioRxiv - Immunology 2022Quote: The cells previously frozen in plates were thawed on ice and RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) protocol without modification ...
-
bioRxiv - Microbiology 2023Quote: ... a single GFP+ or GFP-J-Lat 11.1 cell was sorted directly into each well of a 96-well PCR plate containing the pre-amplification mastermix consisting of 1 μL One-step RT-PCR enzyme (QIAGEN), 5 μL 5× One-step RT-PCR buffer (QIAGEN) ...
-
bioRxiv - Cancer Biology 2021Quote: ... miRCURY LNA miRNA Custom PCR Panels 96-well plates were ordered from Qiagen. These ready-to-use plates contained specific primer sets pre-coated in the wells ...
-
bioRxiv - Cancer Biology 2023Quote: ... MiRs (61 plus 3 controls) were quantified on a custom PCR plate using the miRCURY LNA miR SYBR Green PCR Handbook (Qiagen, Germany). PCR (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... single cells were sorted into PCR plates containing 5 µl Buffer RLT Plus (Qiagen) with 1% BME and immediately frozen at -80°C for G&T sequencing.
-
bioRxiv - Systems Biology 2019Quote: ... Plates were prepared using the miRCURY SYBR Green PCR Kit (Qiagen, cat. no. 339346) with custom miRCURY LNA PCR primers (Qiagen cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... we pre-coated 384-well plates with a mixture containing the PCR primer mix (Qiagen; sequences and category numbers available through online data repository (17)) ...
-
bioRxiv - Microbiology 2022Quote: ... We performed purification between the two PCRs to reduce contaminants or carry-over of primer dimers using 96-well PCR purification plates (Qiagen Inc., Germantown, MD, USA). The final libraries were quantified with a Qubit Fluorometer (ThermoFischer ...
-
bioRxiv - Genomics 2022Quote: ... The 12 wells from individual plate rows were pooled and cleaned (QIAquick PCR Purification Kit, QIAGEN), and the 30μl elutions resulting from every prep were combined and vortexed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... The RT-quantitative PCRs were carried out in four biological replicates in a 96-well plate (QIAGEN) using a QIAcuity system (QIAGEN) ...
-
bioRxiv - Immunology 2022Quote: ... 4h and 20h post activation 2000 cells were sorted directly into 0.2ml semi-skirted 96 well PCR plate (Peqlab) containing 10μl 1x TCL Buffer (Qiagen) and 1%(v v-1 ...
-
bioRxiv - Genetics 2020Quote: ... Sample libraries were purified using a plate from a MinElute 96 UF PCR Purification Kit (QIAGEN Inc., Hilden, Germany), vacuum manifold ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT2 Profiler PCR Array Mouse WNT Signaling Pathway ABI 7900HT Standard Block plates (Qiagen; Cat. No. PAMM-043ZA) were used for qPCR.
-
bioRxiv - Synthetic Biology 2024Quote: ... Samples were prepared in duplicates in a standard 96-well PCR plate and transferred to a QIAcuity 8.5k 96-well Nanoplate (Qiagen) for partitioning using the Qiagen Standard Priming Profile ...
-
bioRxiv - Neuroscience 2019Quote: ... Relative gene expression was measured using RT2 Profiler low-density PCR plates preloaded with qPCR primer assays for genes encoding GABA- and glutamate-related targets (PN: PARN-152ZA, Qiagen). Thermal cycling and data collection were accomplished using an ABI Real-Time PCR 7300.
-
bioRxiv - Cancer Biology 2020Quote: ... Our panel of 88 target genes was prepared on a 96-well plate format with housekeeping genes and controls (RT2 PCR array, Qiagen). Expression was quantified on an ABI7500 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µl of the cell suspension from each dilution was dispensed into 24 wells of a 96 well plate containing 2 μl One-step RT-PCR enzyme (Qiagen), 10 μl 5x One-step RT-PCR buffer (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl of amplified cDNA from each well of a 96-well plate were pooled and completed to 500 μl with PCR-grade H2O (Qiagen). Two rounds of 0.6X solid-phase reversible immobilization beads (AmpureXP ...
-
bioRxiv - Immunology 2024Quote: ... The relative quantification of the genes of interest was carried out in a 10 μl reaction volume in white ultraAmp 384 well PCR plates (Sorenson, Bioscience, Salt Lake City, UT, USA) using the QuantiTect SYBR Green (Qiagen) and LightCycler® 480 system (Roche Diagnostics ...
-
bioRxiv - Microbiology 2019Quote: ... Quantification of influenza virus nucleic acid load in tissues was performed in 96-well plates with 20µL final volume according to the manufacturer instructions (QuantiFast SYBR Green PCR, Qiagen, Toronto, Canada), 2µl of cDNA and a final concentration of 1µM of each primer ...
-
bioRxiv - Genetics 2019Quote: ... in 384 well plates in a total volume of 5 μl with 2.5 μl Qiagen Multiplex PCR Plus Kit (Qiagen, Hilden, Germany) and 1 μl Qiagen Q-solution using a Yakima Yellow-labelled primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Genomics 2023Quote: ... 50 nuclei were sorted into each well of 4 twin.tec™ 96 Well LoBind PCR Plates that had 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... PCR product was purified by PCR QIAquick PCR Purification Kit (QIAGEN) and subjected to MiSeq (Center for Computational and Integrative Biology DNA Core ...
-
bioRxiv - Microbiology 2019Quote: ... Influenza virus nucleic load was determined by qRT-PCR using influenza virus segment M specific primers (IAV-M; Table. 1) in 96-well plates according to the manufacturer instructions (OneStep RT-PCR, Qiagen, Toronto, Canada). Absolute quantification was performed using a standard curve based on a 10-fold serial dilution of a plasmid containing the A/Guinea Fowl/129/2015(H5N9 ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR products (PCR purification kit, Qiagen) of CHPV and JEV positive samples were sent for sequencing ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification (Qiagen, Taq PCR Core Kit) was used to create more copies with a T7 promoter that was added to the 5’ end of the forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR purified (QIAquick PCR Purification kit, QIAGEN), and used in T7 reverse transcription reactions (MEGAscript ...
-
bioRxiv - Microbiology 2023Quote: ... PCR purification (Qiagen QIAquick PCR Purification Kit) was used to isolate the linearized PCR product ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The PCR products were purified using the PCR QIAquick PCR cleanup kit (Qiagen, 28106) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Purification of PCR products was done using PCR QIAquick PCR cleanup kit (Qiagen, 28106), according to product instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Animal genotyping PCR (Taq PCR Master Mix, Qiagen) samples were run on either 0.8% or 2.0% agarose gels ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified (Qiagen PCR purification Kit) and eluted in 50 μl of 0.1 M NaHCO3 solution ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified (Qiagen PCR purification kit) and assembled with pMV306hyg that was linearized by digestion with NcoI using HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Cell Biology 2019Quote: RT-PCR or PCR products were cleaned up with QIAquick PCR purification kit (28106, QIAGEN) or QIAquick Gel Extraction kit (28706 ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was followed by PCR purification using a QIAquick PCR Purification kit and protocol (Qiagen). About 50 ng of cleaned PCR product of either DENV2 or ZIKV was separately cloned into a TOPO-TA PCR cloning vector (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and a DNA Engine Opticon System (GRI) ...
-
bioRxiv - Microbiology 2020Quote: PCR products obtained by above RT-PCR were purified by QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were purified using PCR purification (Qiagen), followed by restriction enzyme digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
bioRxiv - Plant Biology 2020Quote: ... 2.0 μL of PCR buffer (Qiagen 10x PCR Buffer), 1.0 μL of DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified QIAquick PCR Purification Kit (Qiagen) and cloned into the pCRII-TOPO-TA vector (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were purified using PCR purification kit (Qiagen) and digested with restriction enzyme KpnI-HF (New England BioLabs ...