Labshake search
Citations for Qiagen :
101 - 150 of 4685 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Indexed-libraries were obtained by enrichment PCR with 1x HotStarTaq Master Mix (Qiagen), 100 nM of each primer and 10 µl bisulfite-converted DNA in 40 µl reactions (PCR settings ...
-
bioRxiv - Cell Biology 2021Quote: ... End-point PCR assays were performed with AllTaq Master Mix (Qiagen, Hilden, Germany), following manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10x CoralLoad PCR buffer and 5 µl of TopTaq Master Mix 2x (Qiagen). An initial denaturation cycle of 94°C for 6 min was followed by 35 cycles of 94°C for 45 s ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using the HotStarTaq Master Mix Kit (Qiagen; Germantown Road, MD) under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... reaction mixes were prepared with 10 μL QuantiTect Probe PCR master mix (QIAGEN), 1.0 μM primer and 0.25 μM probe ...
-
bioRxiv - Cancer Biology 2023Quote: ... consisting of 10 μl of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 7.2 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... One µl of cDNA was added to SYBR Green PCR Master Mix (Qiagen) and subjected to PCR amplification (one cycle at 95°C for 20 seconds ...
-
bioRxiv - Developmental Biology 2023Quote: ... comprising of 12.5 μL Quantifast SYBR green PCR master mix (Qiagen©, UK), 2.5 μL (10μM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed PCR in a 10 µL volume containing 1x multiplex PCR master mix (Qiagen Hilden, Germany), 5-20 ng of genomic DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and real time quantitative PCR was carried out using SYBR Green Real Time PCR master mix (Qiagen). Normalization of target genes were done against TATA-box-binding protein (TBP ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCR reactions were performed in 50µl volume containing: 25µl of Taq PCR Master Mix (QIAGEN, Germany), 2.5µl of BSA (0.2 μg/μL) ...
-
bioRxiv - Genomics 2023Quote: The PCR was performed with the Multiplex PCR Kit (Type-It Microsatellite master mix; Qiagen, Hilden, Germany). The SSR primer mix consisted of eight primers (see Table 2 and Table 3) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCRs for DH31 and DH31R alleles were conducted using the Taq PCR Master Mix Kit (Qiagen, # 201445) and all primers were synthesized by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μL of 2X master mix (TopTaq™ Master Mix, Qiagen, Hilden, USA) and 0.5 μL of each primer from a working solution of 20 μM (final concentration of 0.4 μM) ...
-
bioRxiv - Physiology 2023Quote: Quantitative real-time PCR (RT-qPCR) assays were performed using SYBR Green qRT-PCR master mix (QuantiNova SYBR Green PCR Kit, Qiagen) with primers designed using the Primer3 software (primer3.ut.ee ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 μL of primer mix (with a fluorescently labelled forward primer) at 0.2 μM and 1 μL QIAGEN Multiplex PCR Master Mix (QIAGEN). PCR cycling conditions were 95 °C for 10 min followed by 35 cycles of 95 °C for 30 s ...
-
bioRxiv - Physiology 2019Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Physiology 2019Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative PCR was performed with RT2 SYBR Green qPCR Master Mix (QIAGEN, Hilden, Germany), using an AC1000 Touch™ Thermal Cycler (Bio-Rad Laboratories ...
-
bioRxiv - Physiology 2020Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription was initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Systems Biology 2022Quote: ... confirmed by two PCRs (Supp. Fig. 1B and 1B′) by HotStarTaq Master Mix (Qiagen) using the following primers ...
-
bioRxiv - Physiology 2020Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Reverse transcription was initiated with a hold at 50°C for 10 minutes (cDNA synthesis ...
-
bioRxiv - Developmental Biology 2022Quote: qPCRs were performed using the QuantiTectTM SYBR® Green PCR Master mix (QIAGEN, 204143) and ran on a Bio-Rad CFX96 system.
-
bioRxiv - Physiology 2023Quote: ... and 5 μl of QuantiFast SYBR Green RT-PCR Master Mix (Qiagen, Manchester, UK). Each sample was analysed in duplicate ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR amplification was done with Qiagen’s HotStarTaq Master Mix Kit (Qiagen, Cat. No. 203443), with 20 ng of converted DNA and 0.2 µM for each of primers in 30 µL final volume ...
-
bioRxiv - Immunology 2019Quote: ... SYBR Green Master mix (Qiagen) was used targeting the following genes ...
-
bioRxiv - Microbiology 2023Quote: ... SYBR green master mix (Qiagen) using the QuantStudio 6 Flex real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time PCR was performed using RT2 Profiler PCR array in combination with RT2 SYBR green master mix (Qiagen) using a QuantStudio 6 Flex real-time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... SYBR green real-time PCR assay was carried out in a 20μL PCR mixture volume consisting of 10 μL of 2X Quantitect SYBR green RT-PCR Master Mix (Qiagen) containing HotStarTaq DNA polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: RT-PCR was performed using the SYBR green master mix (RealQ plus 2X, Qiagen-Germany). Amplification was done by Exicycler96 (Bioneer-S ...
-
bioRxiv - Genetics 2019Quote: ... 4 μl of PCR products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Microbiology 2021Quote: ... A 28 cycle PCR was performed using the HotStarTaq Plus Master Mix Kit (Qiagen, USA) under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were conducted using the HotStarTaq Plus Master Mix Kit (Qiagen, Valencia, CA, USA) and barcoded forward primers ...
-
bioRxiv - Plant Biology 2019Quote: ... containing 12.5 μl of 2X Rotor-Gene® Multiplex PCR Master Mix (Qiagen, Valencia, CA), 2 μl of primer mix (6.25 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... a total of 20 μl PCR solution was mixed with 10μl HotStartTaq Master Mix (Qiagen, containing 1 unit of HotStartTaq DNA Polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR was performed using the HotStar Taq Plus Master Mix Kit (Qiagen Inc, Texas, USA) under the following conditions ...
-
bioRxiv - Genetics 2024Quote: ... The master mix was composed of 10 µL 2x QuantiTect Multiplex PCR NoROX reagent (Qiagen), 0.5 µM of each primer and 2 µL DNA template ...
-
bioRxiv - Immunology 2024Quote: ... A third round of PCR was performed with HotStar Taq DNA polymerase master mix (Qiagen) using primers with barcodes specific to the plate number and well location as well as adapters appropriate for sequencing on an Illumina MiSeq.
-
bioRxiv - Neuroscience 2022Quote: ... Five μl of reverse transcribed cDNA samples were pre-amplified using RT2 preamp PCR master mix with PBR-152Z RT2 preamp pathway primer mix (Qiagen, Inc.) on a thermal cycler under the following conditions ...
-
bioRxiv - Microbiology 2019Quote: ... Each reaction mix comprised 10 μL of 2x Rotor-Gene Multiplex PCR Master Mix (Rotor-Gene Multiplex PCR Kit, catalogue no. 204774; Qiagen), 1 μL of a mix of primers and probes (to give final concentrations of 0.5 mM each primer and 0.2 mM each probe) ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time quantitative PCR was performed on the Applied Biosystems 7500 system with QuantiTect SYBR Green PCR Master Mix (Qiagen) and the appropriate primers ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Immunology 2023Quote: ... cDNAs were synthesized using High Capacity RNA-to-cDNA kit (ThermoFischer Scientific) and quantitative RT-PCR were carried out using specific primers (Table S2) and SYBR Green PCR Master Mix (Qiagen). PCR amplification of Gapdh was performed to control for sample loading and normalization between samples ...
-
bioRxiv - Microbiology 2023Quote: ... Triplicate PCRs were carried out in 15 µl reactions containing 1x UCP Multiplex PCR Master Mix (Qiagen, Venlo, The Netherlands), 0.3 μmol l−1 each of the forward and reverse primers ...
-
bioRxiv - Immunology 2024Quote: ... 1 μl of the first round PCR product was used as a template for the second nested PCR reaction using HotStartTaq Master Mix Kit (QIAGEN). The cycling conditions for the second PCR reaction were 95°C for 5 min ...
-
bioRxiv - Microbiology 2019Quote: The TopTaq Master Mix Kit (Qiagen) was used for the amplification of all positive HBoV samples following the manufactures instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using QuantiFast SYBRGreen Master Mix (Qiagen) following the manufacturers recommendations ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
bioRxiv - Genomics 2019Quote: ... 25 μl HotStarTaq Master Mix (Qiagen) and 10 pmol of each primer ...
-
bioRxiv - Neuroscience 2022Quote: ... using SYBR-Green Master Mix (Qiagen), with primers for target genes (Malat1 ...