Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: RNA from 1205Lu cells and immortalized human melanocytes were isolated and purified using RNeasy Micro Kit (Qiagen) according to manufacturer’s instruction and concentration was quantified using a NanoDrop Spectrophotometer (ThermoScientific) ...
-
bioRxiv - Genomics 2024Quote: ... the effect of human rRNA removal was also assessed using a QIAseq FastSelect rRNA removal kit (Qiagen). The rRNA removal reaction was performed after RNA thermal denaturation at 95℃ 5 min according to the instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen, Hilden, Germany) or TRIzol reagent (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2024Quote: The RNA quality of human kidney FFPE sample was checked by RNeasy FFPE kit (Qiagen-Cat #73504) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Genomics 2022Quote: ... The 12 wells from individual plate rows were pooled and cleaned (QIAquick PCR Purification Kit, QIAGEN), and the 30μl elutions resulting from every prep were combined and vortexed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were transfected using Effectene transfection kit for individual dishes or 24 well plates (Qiagen) or Linear PEI (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Colonies were scraped off the plates and plasmids were extracted with a plasmid maxiprep kit (Qiagen).
-
bioRxiv - Microbiology 2019Quote: Microbial genomic DNA was extracted from the human stool samples using the DNeasy PowerSoil DNA Isolation Kit (Qiagen). The V4 region of 16S rRNA gene was amplified and sequenced using the Illumina MiSeq platform(67) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human HDL (40nM) or PBS for 48 hours prior to RNA isolation using the RNeasy Mini kit (Qiagen). RNA samples were converted to cDNA libraries by the Northwestern University Genomics Core facility and were then run on the Illumina HT-12 microarray ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 22 human vaginal samples using the QIAamp UCP Pathogen Mini Kit (QIAGEN, Venlo, Netherlands) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA from murine or human monocytes was isolated using AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, 80224). DNA (1 µg ...
-
bioRxiv - Neuroscience 2021Quote: The total RNA from mouse cortex and human PBMC was extracted using the RNeasy® Mini Kit (Qiagen) and real-time PCR was done as described in the Supplementary material.
-
bioRxiv - Neuroscience 2020Quote: ... RNA was isolated from human autopsy brain tissue using the RNeasy Plus Universal Mini Kit (Qiagen Cat# 73404).
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Bulk gDNA and RNA from human retinal organoids were isolated using the AllPrep DNA/RNA Micro Kit (Qiagen) or DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from human glioblastoma cells using the RNeasy kit according to the manufacturer’s instructions (Qiagen). RNA quality was assessed on a Bioanalyzer (Agilent ...
-
bioRxiv - Pathology 2023Quote: Total RNA was extracted from the frozen human stomach tissues using the RNeasy plus Mini Kit (Qiagen, US) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was collected from treated human or murine primary spinal cord astrocytes using an RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human myeloma cell lines were authenticated by subjecting genomic DNA isolated with the QIAamp DNA Mini Kit (Qiagen), and short tandem repeat (STR ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from the human biopsy samples and mice colon tissue was isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... DNA extractions were performed using a DNeasy PowerSoil 96-well plate DNA extraction kit (Qiagen, Hilden, Germany). The standard protocol was used with the following two exceptions ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... colonies were scraped off plates and library plasmids purified using a Qiagen HiSpeed Maxi kit (Qiagen, 12662). Plasmids were eluted in Qiagen Buffer TE ...
-
bioRxiv - Immunology 2023Quote: ... A second round of PCR was performed to generate uniquely barcoded sequencing libraries using the barcode primer plate included in the kit (17μL of working mix which include 12.5μL QIAGEN 2x Multiplex PCR master mix ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and human BON1 cell line [8] were isolated with RNeasy Plus Universal Kits (Qiagen Cat no. 73404, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... miScript miRNA PCR array of Human Neurological Development and Disease was performed using miScript SYBR green PCR kit (Qiagen). The PCR array contains 84 miRNAs which are differentially expressed during neuronal development and are responsible for progression of neurological diseases.
-
bioRxiv - Cell Biology 2021Quote: The human VCP cDNA was reverse transcribed from total RNA by using Omniscript RT kit (Qiagen Japan, Tokyo, Japan) extracted from A549 cells (RIKEN Cell Bank ...
-
bioRxiv - Microbiology 2021Quote: Bacterial DNA was extracted from human and mouse feces-derived bacterial supernatant using the DNeasy powersoil kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from both NHP and human stool samples using the PowerFecal DNA Isolation Kit (Qiagen, Valencia, CA). Sequencing of the 16s small subunit ribosomal ribonucleic acid (SSU rRNA ...
-
bioRxiv - Microbiology 2023Quote: ... Human DNA from whole cell extracts of A549 cells was purified using the DNeasy Blood and Tissue kit (Qiagen). RNAseA (Thermo ...
-
bioRxiv - Microbiology 2023Quote: Total genomic DNA was extracted from human tissue and cyst fluid using the QIAamp Mini kit (Qiagen, Hilden, Germany). Extractions were performed per manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: RNA was extracted from human tissue derived organoids and neutrophils using the RNeasy® Plus Mini Kit (Qiagen, #74104) with cDNA prepared using a SuperScript™ VILO™ cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...