Labshake search
Citations for Qiagen :
101 - 150 of 1999 citations for OX7 Anti Thy 1 Mouse Monoclonal biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... and with a mouse antibody against the His-tag (Tetra·His Antibody, QIAGEN-Cat. No.34670, 1:2,000) in blocking solution on a rocker ...
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA was extracted from monoclonal cells using DNeasy Blood and Tissue kit (Qiagen) following the instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples for total or 4sU labeled RNA were immediately resuspended in Qiazol lysis reagent (Qiagen, 79306) for RNA extraction ...
-
bioRxiv - Bioengineering 2022Quote: ... Scrambled siRNA and Alexa Fluor 546 labeled siRNA (AF546-siRNA) were purchased from Qiagen (MD, USA). mRNA targeting firefly luciferase was purchased from Trilink Biotechnologies (CA ...
-
bioRxiv - Cell Biology 2019Quote: ... Cy3-labeled miR-430 was separated from unconjugated dyes using a QIAquick Nucleotide Removal Kit (QIAGEN).
-
bioRxiv - Biochemistry 2021Quote: ... The Cy3-CTP labeled cRNA sample was purified using the Qiagen RNeasy column (Qiagen, Cat # 74106). The concentration of cRNA and dye incorporation was determined using Nanodrop-1000.
-
bioRxiv - Cell Biology 2022Quote: ... Dual labeled miRCURY LNA miRNA detection probes of dre-mir-430a-3p and scramble-miR (Qiagen, catalogue no ...
-
bioRxiv - Biochemistry 2021Quote: ... The coverslips were then incubated for ~ 10 min with 4 μg/ml of Penta•His biotin conjugate antibody (34440, Qiagen, UK) in reaction buffer [40 mM HEPES buffer (pH 7.3 ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were washed with PBS-T (PBS1x/0.1% Tween 20) and incubated with mouse antibody against 6xHis-tag (1:2,000; Qiagen), rabbit antibody against GST-tag (1:10,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... Chambers were washed with BRB80 and then were coated with mouse antibody against 6xHis-tag (1:50; Qiagen) for 10 min ...
-
bioRxiv - Microbiology 2021Quote: Mouse lung tissues were homogenized in 1 ml of MEM-free media using TissueRuptor (Qiagen, Chadstone, Victoria, Australia). The homogenate was obtained by centrifugation at 6,000 × g for 5 min at 4℃ ...
-
bioRxiv - Cancer Biology 2023Quote: Approximately 1 cm of the mouse distal ileum was cut into small pieces and stored in RNAlater (Qiagen). RNA was prepared using a combination of Trizol (Ambion ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Cell Biology 2020Quote: ... The eluted 4sU-labeled RNA and reserved total RNA were purified with the miRNeasy Micro kit (Qiagen) according to the manufacturer’s protocol with on-column DNase I treatment ...
-
bioRxiv - Genomics 2021Quote: ... The fragmented and labeled DNA samples were purified from excess nucleotides using “QIAquick PCR Purification Kit” columns (QIAGEN), according to manufacturer’s recommendations.
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen), for 5 min at 50 Hz ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Immunology 2022Quote: ... For this analysis bacterial DNA was isolated either from feces or from 1 cm of mouse terminal ileum using QIAmp Fast DNA Stool kit (QIAGEN). qPCR was performed using SYBR Green I qPCR Master mix on LC480II Light cycler (Both Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed twice in PBS and DNA was labeled with propidium iodide (50 μg/ml) in presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.1%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA was labeled with propidium iodide (50 μg/ml) in the presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.01% ...
-
bioRxiv - Biochemistry 2020Quote: ... These monoclonal populations were validated by PCR on extracted genomic DNA (using the Blood & Tissue Kit, Qiagen).
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (LNA oligonucleotides targeting FLAP X and FLAP Y labeled with TYE 563, Qiagen) were pre-hybridized in either 100μL of 1X SSC for conventional smiFISH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng DNA was random prime labeled (ENZO) with Cy3 (Sample DNA) or Cy5 (Input DNA) and purified on a MinElute PCR purification column (Qiagen). Labeled DNA was diluted in hybridization buffer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (TYE 563 labeled LNA oligonucleotides targeting FLAP X and FLAP Y, Qiagen) were pre-hybridized in 100 μL of the following buffer ...
-
bioRxiv - Microbiology 2020Quote: ... and a portion of the tissue (0.08-0.3g) was placed into pre-labeled microcentrifuge tubes containing 5 mm stainless steel beads (Qiagen Inc., CA). Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods) were boiled for 2 minutes ...
-
bioRxiv - Neuroscience 2022Quote: PCR with forward and reverse primers (see Table 1) was performed on mouse hypothalamic cDNA (isolated with miRNeasy Mini Kit, Qiagen, Hilden, Germany). PCR products were ligated into pGEMT.easy (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Mouse and viral DNA were isolated from mouse tissue using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). iTAQ universal Syber Green supermix (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... We checked ASOs penetration in cells by means of the 5′-FAM-labeled control ASO A provided by Qiagen (Figure S5f).
-
bioRxiv - Immunology 2022Quote: ... after which the cells were stained with anti-Penta-His-AF647 (1 µg/mL; Qiagen) for 30 minutes at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... the precipitates were subjected to Western blot analysis with anti-penta-His (1:2000, Qiagen) and anti-FLAG M2 (1:4000 ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Neuroscience 2022Quote: PON2 level was quantified in the mouse whole brain homogenate in 100 mg per 1 ml of QIAzol® lysis reagent (Qiagen, Hilden, Germany). mRNA 500 ng was used for cDNA synthesis in 10 μl volume according to the manufacturer’s instructions of PrimeScriptTM RT-PCR kit (Takara Bio Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The labeled protein in the soluble fraction was purified using Immobilized Metal Affinity Chromatography (IMAC) using standard methods (QIagen Ni-NTA resin). The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... End-labeled lambda DNA was purified using Qiaex II gel-extraction DNA clean-up kit following the manufactures’ instructions (Qiagen cat# 20021).
-
bioRxiv - Cell Biology 2022Quote: Mouse Plin2 homology arms were obtained by extracting DNA from mouse primary mouse NSPCs from the SVZ using DNeasy Blood & Tissue Kit (#69506, Qiagen). The sequences covering the sgRNA target site were extracted from the genomic DNA using PCR ...
-
bioRxiv - Genomics 2022Quote: ... The DNA from mouse bladder tumors and matched germline DNA from mouse tails were extracted using the DNeasy Blood Tissue kit (Qiagen) according to the manufacturer’s instructions ...