Labshake search
Citations for Qiagen :
151 - 200 of 376 citations for Nucleic Acid Stains since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Three nucleic acid extraction kits designed for DNA and RNA extraction were compared: DNeasy PowerWater kit (QIAGEN; Hilden, Germany), NucleoSpin Soil ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from stool samples using the RNeasy PowerMicrobiome kit automated on the QIAcube (Qiagen, Germantown, MD, USA), excluding the DNA degradation steps ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... using Qiagen DNA Blood and Tissue Mini kit on a QIAcube automated nucleic acid extraction system following manufacture’s protocol (Qiagen, MD). The nine whole-genome resequencing samples were extracted from ear pinna by mincing the tissue and incubating it overnight in 200 ug/ml Proteinase K at 55 °C with gentle shaking ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, QIAGEN Strasse 1, 40724 Hilden, Germany), which purifies RNA and DNA ...
-
bioRxiv - Genomics 2023Quote: ... Samples were clarified by centrifugation at 2,000 rpm for 10 minutes and subjected to nucleic acid extraction using the cador Pathogen 96 QIAcube HT Kit (Qiagen) in a QIAcube HT automated extractor (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... primary hippocampal neurons were transfected in duplicates or triplicates using 150ng of a plasmid carrying enhanced GFP-gene in combination with 5nmol Power Lock-Nucleic Acid inhibitors (Qiagen) against miR-218-5p ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient cell-free DNA was extracted from 1ml-1.2ml of patient plasma using the QIAamp Circulating Nucleic Acid Kit (QIAGEN # 55114) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Frozen pancreas tissue was homogenized using a motorized pestle prior to conducting nucleic acid extraction using the Qiagen AllPrep Universal kit (Qiagen). The processing of all samples was randomized to minimize batch effects attributed to age or sex ...
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids (DNA/RNA) were isolated from flash-frozen tissues using the All Prep DNA/RNA Mini Kit (Qiagen, Germantown, MD) as previously described [127–129] ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Microbiology 2021Quote: Samples were homogenized and nucleic acids were extracted using the MoBio RNA PowerSoil® Total RNA Isolation Kit (Qiagen, CA, USA) and the MoBio RNA PowerSoil® DNA Elution Accessory Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: Frozen tissues were weighed and homogenized in RLT and nucleic acids were extracted using the AllPrep DNA/RNA Mini Kit (QIAGEN, #80204) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was isolated using the RecoverAll Total Nucleic Acid Isolation Kit (Thermo #AM1975) and concentrated using the RNeasy MinElute Cleanup Kit (Qiagen #74204). Library preparation and sequencing were performed by the Genome Sequencing Facility at St ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid extractions were performed by combining equal amounts of cell culture supernatants with RLT Lysis Buffer (Qiagen, Germantown, MA, USA), with 200 µL of the lysate used for magnetic bead-based extraction according to the manufacturer’s protocol ...
-
First complete genome characterization of an Indian pigeon pox virus directly from a clinical samplebioRxiv - Evolutionary Biology 2023Quote: ... The extraction of nucleic acid from infected scab samples was performed by using DNeasy blood and tissue purification Kits (QIAGEN, USA) with some modification established by Sarker et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Hsa-miR-124-3p Locked Nucleic Acid (LNA) power inhibitor and has-miR-124- 3p miRCURY LNA miRNA mimic (Qiagen, Germantown, MD) were resuspended with RNase-free water to 100 μM ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit, Qiagen, Valencia, CA) and quantified using a Qubit fluorometer 3.0 (high sensitivity double-stranded DNA kit ...
-
bioRxiv - Microbiology 2020Quote: We evaluated the impact of using Nanotrap particles to capture and concentrate SARS-CoV-2 on several nucleic acid extraction methods: the QIAamp® Viral RNA Mini Kit from QIAGEN (52906); the RNeasy® Mini Kit from QIAGEN (74106) ...
-
bioRxiv - Systems Biology 2021Quote: Approximately 10 mL of amniotic fluid from each animal was used for cell-free RNA extraction with the QIAamp Circulating Nucleic Acid Kit (QIAGEN, Valencia, CA). RNA from the lung and hippocampus was extracted with the RNeasy Universal Mini Kit (QIAGEN ...
-
Cell-free DNA as a biomarker for prostate cancer: elevated concentration and decreased fragment sizebioRxiv - Cancer Biology 2020Quote: ... DNA was extracted from 7 to 55 mL of plasma using the Qiagen QIAamp Circulating Nucleic Acid Kit (Qiagen, Redwood City, CA), and double eluted with 40 μL of Qiagen Elution Buffer ...
-
bioRxiv - Cell Biology 2020Quote: RNA FISH was performed using a FITC-labeled DNA oligo probe complementary to alpha satellite (Integrated DNA Technologies, Newark, NJ) or a biotinylated locked nucleic acid (LNA) oligo probe complementary to HSATII (QIAGEN, Hilden, Germany) (see Key Resources Table) ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA from MCF7 cells was isolated by proteinase K digestion at 65°C for 30 minutes followed by purification using the QIAamp circulating nucleic acid kit (Qiagen, Venlo, The Netherlands). Genomic DNA from frozen tissue sections of colorectal liver metastases was isolated using the NucleoSpin Tissue kit according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was then purified using a nucleic acid binding column with on-column DNase treatment (RNase-free DNase set, QIAGEN, Germantown, MD, USA). RNA was then eluted from the column in elution buffer.
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acid was extracted from 200 μl of each sample using the QIAamp MiniElute™ Virus Spin Kit nucleic acid (for DNA and RNA) according to the manufacturer (QIAgen Canada, Toronto, ON, Canada). DNA samples were stored at −80°C and assayed in duplicate by qPCR ...
-
bioRxiv - Microbiology 2023Quote: A 200 L sample of faecal slurry was subjected to automated nucleic acid extraction using the RNeasy PowerMicrobiome kit on the QIAcube device (Qiagen, German-town, MD, United States). With the exception of skipping the phases for DNA degradation ...
-
bioRxiv - Microbiology 2019Quote: ... cells were resuspended in 50 μL stain buffer (FACS buffer containing Qiagen Penta-HIS Alexa Fluor 647 #35370 at a final concentration of 5 μg/mL and Sigma-Aldrich Monoclonal Anti-HA-FITC ...
-
bioRxiv - Immunology 2021Quote: ... Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) was used to purify the protein via gravity flow and proteins were eluted as previously described37,38 ...
-
bioRxiv - Genetics 2020Quote: Iron nitrilotriacetic acid (NTA) resin were prepared in-house by stripping metal ions from nickel nitrilotriacetic acid agarose resin (Qiagen) with 100 mM ethylenediaminetetraacetic (EDTA ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a nickel-nitrilotriacetic acid column (Qiagen) and then dialyzed against buffer comprised of 10 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2019Quote: ... mixed with nickel-nitrilotriacetic acid-agarose resin (NiNTA, Qiagen) and allowed to rotate end-over- end at 4°C for 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... coli lysates using a nickel-nitrilotriacetic acid superflow resin (Qiagen) then combined and sent for anti-sera production (Covance) ...
-
bioRxiv - Microbiology 2022Quote: A PowerSoil Deoxyribonucleic Acid (DNA) Extraction Kit (QIAGEN, Hilden, Germany) was used to extract genomic DNA from fecal samples according to the manufacturer’s instructions ...