Labshake search
Citations for Qiagen :
201 - 250 of 1882 citations for Nucleic Acid Electrophoresis Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Engineering of a fluorescent chemogenetic reporter with tunable color for advanced live-cell imagingbioRxiv - Molecular Biology 2021Quote: ... The products of restriction enzyme digests were extracted and purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen). Restriction endonucleases ...
-
bioRxiv - Biochemistry 2021Quote: ... The CYP168A1 optimized cDNA insert was removed from the plasmid using NdeI and HindIII restriction enzymes and isolated using agarose gel electrophoresis and the Qiagen Gel Extraction Kit (Qiagen) for ligation into a similarly digested and isolated pCWOri+ CYP expression vector (113) ...
-
bioRxiv - Genetics 2022Quote: ... Reactions were purified using agarose gel electrophoresis and target fragments were excised and purified using QIAquick and MinElute Gel Extraction Kits (Qiagen) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2020Quote: ... The resulting ~440 bp long PCR product was subjected to electrophoresis using an agarose gel and extracted using Gel Extraction Kit (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The resulting ~500 bp long PCR product was subjected to electrophoresis in agarose gels and purified using Gel Extraction Kit (Qiagen). The samples were mixed in equimolar ratios to obtain 30 μl of a final concentration of 10-nM and sequenced by Illumina MiSeq (v3 kit ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were run on an agarose electrophoresis gel and the strongest bands excised for purification using a QIAquick Gel Extraction Kit (Qiagen). The purified PCR products were sequenced directly using Sanger sequencing by Genewiz ...
-
bioRxiv - Bioengineering 2023Quote: ... the amplified VH and Vκ/Vλ genes were subjected to electrophoresis on a 1.5% agarose gel and purified using a QIAquick gel extraction kit (QIAGEN Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR products were subjected to electrophoresis on a 1.5% agarose gel and purified using a QIAquick gel extraction kit (QIAGEN Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... the amplified genes were subjected to electrophoresis on a 1.5% agarose gel and purified using a QIAquick gel extraction kit (QIAGEN Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... All reactions from each screen were pooled and the amplified PCR product (~240–250 bp) was purified by agarose gel electrophoresis using the QIAquick gel extraction kit (Qiagen). Purified PCR products were quantified by fluorescence using the Qubit dsDNA high sensitivity assay kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The amplified library (88 bp) was purified by agarose gel electrophoresis and extracted using the QIAquick gel extraction kit (Qiagen). Purified PCR products were digested with BlpI and BstXI and the digested fragment was purified on a 20% polyacrylamide Tris–borate–EDTA (TBE ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were resolved by agarose gel electrophoresis and JH4 intron sequences with size of 1.2 kb were extracted by QIAquick Gel Extraction Kit (Qiagen; 28706X4). DNA of JH4 sequences was ligated into the pCR-Blunt II-TOPO vector (ThermoFisher ...
-
bioRxiv - Genomics 2023Quote: ... Next the correct sizes of the linearized backbones were isolated using gel electrophoresis and later purified using QIAquick Gel Extraction Kit (QIAGEN). For the library of 7 domains ...
-
bioRxiv - Cell Biology 2024Quote: ... The genomic DNA fragment was separated by electrophoresis using a 1% agarose gel and purified using QIAquick Gel Extraction Kit (QIAGEN). The genome sequence of drp-1 was determined by Sanger sequencing using primers listed in Supplementary Table S2.
-
bioRxiv - Biochemistry 2022Quote: ... The PCR products were analyzed through capillary gel electrophoresis with the QIAxel instrument (Qiagen). The cPCR-amplified scFv gene was then digested with BstNI endonuclease to obtain and compare the band patterning of each scFv amplified gene ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by extraction of viral nucleic acids using a commercial kit (QIAamp MinElute virus spin kit, Qiagen, Venlo, Netherlands). A portion (2.5 µl ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Microbiology 2020Quote: ... Extraction of viral nucleic acids from clinical sample was performed with a QIAamp Viral RNA Mini Kit (Qiagen #52906) as described by manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... Nucleic acid was first extracted from each blood sample using QIAamp MinElute Virus Spin kits (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... followed by total nucleic acid extraction of 400 ul of pretreated stool using the EZ1 Virus Mini Kit v2.0 (Qiagen). Extracts were eluted in 60 ul volume.
-
bioRxiv - Microbiology 2019Quote: Nucleic acids from the seven new isolates were extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) or MasterPure Complete DNA and RNA Purification Kit (Epicentre ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids from each sample were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen). Viral RNA yields were measured using a RT-qPCR assay targeting the rdrp gene as previously described[13].
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then lysed and the nucleic acid was extracted using Qiagen Allprep DNA/RNA Mini Kit (Qiagen). Aliquots of DNA were sent to Novogene Co ...
-
bioRxiv - Microbiology 2023Quote: ... Extractions of viral nucleic acids from 140 µl samples were performed with the QIAamp Viral RNA Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were moved on magnet and supernatant was transferred to clean 1.5 mL tubes for nucleic acid extraction using the MinElute PCR Purification Kit (Qiagen). Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: We extracted nucleic acids from each 200 μL aliquot using the AllPrep PowerViral DNA/RNA kit (Qiagen, Hilden, Germany) using Glass PowerBead tubes included with the kit ...
-
bioRxiv - Microbiology 2023Quote: ... Three nucleic acid extraction kits designed for DNA and RNA extraction were compared: DNeasy PowerWater kit (QIAGEN; Hilden, Germany), NucleoSpin Soil ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Genetics 2022Quote: ... between 264 bp and 464 bp were re-separated and purified from the gel band in electrophoresis by QIA quick gel extraction kit (Qiagen, Hilden Qiagen, Germany); and the paired obtained sequences (terminal 125 bp ...
-
bioRxiv - Neuroscience 2019Quote: ... a 92kb Egr1-FRT-ERT2-Cre-ERT2-FRT BAC fragment generated from PmeI and PacI double digestion and a 61kb Snap25-Flpe BAC fragment generated from SbfI and PmeI double digestion was purified using pulsed field gel electrophoresis followed by gel extraction (Qiagen #20021). The pronuclei of fertilized one-cell eggs of C57BL/6j mice were co-injected with a mixture of equimolar amounts of the two fragments by the Department of Pathology Knockout ...
-
bioRxiv - Cancer Biology 2023Quote: ... amplicons were subjected to agarose gel electrophoresis for product size selection and purified with QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Ligation was performed as previously described [10] ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR products were confirmed by gel electrophoresis and purified with MinElute PCR Purification Kit (Qiagen) prior to sequencing (Retrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The library was size selected by agarose gel electrophoresis and column purified (Qiagen, MinElute, #28606). Single-end sequencing was performed to an average of 30 million reads per sample using Illumina NovaSeq 6000 ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were analysed by gel electrophoresis and purified using QIAquick PCR purification kit (Qiagen). 100 ng purified DNA each from WT and sgRNA treated samples were denatured at 95°C for 5 min in 1× NEB 2 buffer and hybridized following the temperature profile 95 to 85°C at 2°C/s and 85 to 25°C at 0.1°C/s ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We extracted total genomic DNA from blood and/or tissue samples using standard nucleic acid extraction kits (QIAamp DNA Mini Kit; Qiagen) automated on a QiaCube (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 nucleic acids were isolated from 300 µl viral transport media using the QIAamp Viral RNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from stool samples using the RNeasy PowerMicrobiome kit automated on the QIAcube (Qiagen, Germantown, MD, USA), excluding the DNA degradation steps ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Microbiology 2020Quote: ... the samples were diluted further with RTL buffer to give a 1:60 w/v homogenate and total nucleic acid was extracted from 300 μl of the clarified sample using the RNA tissue mini kit without DNase (Qiagen) and eluted in a 60 μl volume.
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...