Labshake search
Citations for Qiagen :
201 - 250 of 2036 citations for Neutrophil cytosol factor 1 NCF1 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Each His-tagged protein in media was captured with Ni-NTA resin (Qiagen) and eluted with DPBS containing 150 mM imidazole.
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Cancer Biology 2022Quote: A ready-to-transduce transcription factor-responsive lentiviral reporter system (CCS-1022L, QIAGEN) was used to generate a stable cell line ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 200nM siRNA/well were used for transfection using 5µl/well of Hi-Perfect (Qiagen) following manufacturer’s recommendation.
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-tagged proteins from the supernatant were incubated overnight with Ni-NTA agarose (Qiagen) at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged proteins were purified by affinity chromatography on Ni-NTA Agarose resin (Qiagen) and eluted with buffer containing 0.5 M imidazole ...
-
bioRxiv - Physiology 2020Quote: ... or the QuantiTect PCR Kit with self-designed primers for neuronal factors (Qiagen, Germany) (Supplementary Table 3) ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: ... The His-tag protein was purified by using a column of Ni-Sepharose 4B (Qiagen), followed by gel filtration using a Superdex 75 column (G.E ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... MCP (His-HaloTag-2xMCP) was purified using its histidine tag with Ni-NTA Agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CSF3R protein was enriched by nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen 30210) and further purified by size-exclusion chromatography on a Superdex 75 10/300 GL column (Cytiva 17517401 ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Microbiology 2023Quote: ... and were probed with either horseradish peroxidase (HRP)- conjugated primary antibodies against His-tag (Qiagen) or with rabbit primary antibodies against HA-tag (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
bioRxiv - Microbiology 2024Quote: ... His-tag-affinity chromatography-purifcation was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Microbiology 2020Quote: ... BipA-His was purified from the soluble fraction by affinity chromatography using Ni-NTA agarose (QIAGEN) previously equilibrated with equilibration buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6x-His-Smt3 was purified from BL21 E.coli cells using a Ni-NTA affinity column (Qiagen) following manufacturer indications ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tagged BASP1 derivatives were prepared using Ni-NTA beads following the manufacturers instructions (Qiagen). Purified proteins were dialysed into Buffer D and stored at −80°C.
-
bioRxiv - Plant Biology 2021Quote: ... HIS-tagged proteins were purified by metal-affinity chromatography using Ni-NTA resins (Qiagen, Hilden, Germany). Protein concentration was estimated by the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and His-tagged Fabs were isolated from cell supernatants using Ni-NTA columns (Qiagen, Hilden, Germany). IgGs ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 nM siRNA/well were used for transfection using 0.8 µl/well of Hi-Perfect (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The expressed protein was purified as His-tagged fusion protein using Ni-NTA agarose beads (Qiagen) and analyzed by SDS-PAGE.
-
bioRxiv - Neuroscience 2020Quote: ... The His-tagged target protein was purified by Ni-NTA gravity-flow chromatography (Qiagen, Hilden, Germany). The eluted protein was subjected to MonoQ 10/100 GL (GE Healthcare Lifesciences ...
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Biochemistry 2024Quote: ... Proteins modified with 6×-His-Ub was purified using Ni-NTA Sepharose (142350243, Qiagen, Alameda, CA) on a rotating platform for 2 hours at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified using the His-tag Protein Purification Kit (Ni-NTA Agarose, QIAGEN GmbH), GST-tag Protein Purification Kit (Glutathione Sepharose ...
-
bioRxiv - Molecular Biology 2020Quote: The consensus sequences of piRNA biogenesis factors were assembled using CLC Genomics Workbench version 8.0.1 (QIAGEN) and confirmed by published homolog sequences using BLASTp ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transcription factor prediction was performed using i-cisTarget20 and the upstream regulator function by QIAGEN Ingenuity Pathway Analysis.21 Differentially expressed genes (DEGs ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from INS-1 and human islets 48 hours post transfection using RNeasy cleanup kit (Qiagen) according to manufacturer’s protocol ...