Labshake search
Citations for Qiagen :
1 - 50 of 1448 citations for Mouse anti Plasmodium vivax CSP PVC 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... DNA from the blood of Plasmodium chabaudi infected mice was isolated from QIAmp DNA blood kit (QIAGEN, Valencia, CA) as per the manufacturer instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Strep (Qiagen, Cat# 34850), and mouse anti-Histidine (Invitrogen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Biophysics 2019Quote: ... Biotinylated mouse anti-5xHis antibody was purchase from QIAGEN. Mouse anti Tubulin beta 3 antibody from BioRad (Hercules ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-Strep-tag II epitope mouse monoclonal antibody # 34850 (QIAGEN), anti-6xHis-tag mouse monoclonal antibody # H1029 (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Biochemistry 2023Quote: ... and mouse anti-Phospho-Serine Q5 (catalogue number: 37430) was from Qiagen. Horseradish peroxidase-conjugated secondary antibodies against rabbit (catalogue number ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Neuroscience 2022Quote: RNA was isolated from snap frozen striatal mouse tissue from 2 independent cohorts of mice according to the manufacturer’s protocol and purified using RNeasy columns (Qiagen). A total of 13 mRNA libraries for Illumina sequencing were prepared using KAPA mRNA HyperPrep Kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mouse thyroid tissue was homogenized in buffer RLT using TissueLyser II (Qiagen; 2x 2 min cycles at 30 Hz) and 5 mm stainless steel beads ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed overnight using a mouse monoclonal anti-StrepII antibody (Qiagen catalog number 34850) at a 1:2500-1:5000 dilution or a rabbit polyclonal antiserum raised against the PlpD C-terminal peptide NH2-EWLTRVQLGDRQELYSEFYQC-COOH at a 1:5000 dilution ...
-
bioRxiv - Immunology 2022Quote: ... the DNA was extracted from 100 mg mouse fecal samples (9-week-old, 2 weeks after final oral gavage treatment) using QIAamp PowerFecal Pro DNA kit (Qiagen) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... including miRNA was isolated from brains of E11 mouse fetuses (3 biological replicates) at 2 h after irradiation using the miRNeasy Mini Kit (Qiagen). RNA was subsequently processed for hybridization to GeneChip miRNA 4.0 microarrays (Affymetrix ...
-
bioRxiv - Immunology 2021Quote: ... 150 ng DNA per reaction was amplified in duplicate using primers and probes specific to γHV68 Orf50 and mouse Ptger2 (see table) and 2× QuantiNova Probe Mastermix (Qiagen). Standard curves were obtained by serial dilutions of Orf50 and Ptger2 gBlocks (ORF50 ...
-
bioRxiv - Microbiology 2022Quote: ... hACE2 expression or SARS-CoV-2 nucleocapsid (N) gene in individual mouse organs was determined using QuantiNova SYBR Green PCR kit (Qiagen #208052) in combination of 500 nM of hACE2 gene specific primer set (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signal was detected using mouse anti-His antibody from Qiagen (Cat No./ID: 34660 1:500). Anti-mouse HRP was used for colorimetric development (Cat No./ID-A8924 1:1000) ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were used at the following dilutions: 1:1000 anti-penta-His mouse monoclonal (Qiagen), 1:5000 anti-cMyc mouse monoclonal (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... stored at −20° C and characterized by immnoblotting using mouse anti-2xStrep tag (Qiagen #34850, 1:1,000), and secondary goat anti-mouse IgG IRDye® 800CW (LI-COR # 926-32210 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Cell Biology 2021Quote: Antibodies and their conditions of use are as follows: mouse anti-His (Western blot, 1:1000; 34660; Qiagen), rabbit anti-Brl1 (Western blot ...
-
bioRxiv - Biochemistry 2022Quote: ... Memorial Sloan Kettering Cancer Center) at a dilution of 1:5,000) and His (mouse anti-penta-His antibody (Qiagen, cat. #34660) at a dilution of 1:10,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked with 5% milk in PBST (Phosphate buffer saline, 0.05% Tween 20) and incubated with monoclonal mouse anti-His antibody (Penta His, Qiagen, dilution 1:1000) according to the manufacturers’ instructions ...
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...