Labshake search
Citations for Qiagen :
51 - 100 of 611 citations for Mouse anti Enterovirus 70 3651 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Cell Biology 2022Quote: ... the aqueous phase containing RNA was mixed with 70% ethanol and transferred to RNeasy MinElute spin columns (QIAGEN). The cleanup and further concentration of the RNA was done using the standard procedure of RNeasy MinElute Cleanup Kit.
-
bioRxiv - Cancer Biology 2022Quote: ... Approximately 50 mg of fresh tumor tissues were homogenized in ice cold 70% ethanol using TissueLyser II (Qiagen). After spinning down ...
-
bioRxiv - Immunology 2020Quote: ... Particulate viral RNA was extracted from 70 µl of such supernatants using QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s procedure ...
-
bioRxiv - Microbiology 2020Quote: ... viral RNA was extracted from 70 μl plasma using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the aqueous phase containing RNA was mixed with 70% ethanol and transferred to RNeasy MinElute spin columns (QIAGEN). Cleanup and further concentration of the RNA was done using the standard procedure of RNeasy MinElute Cleanup Kit.
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from pooled individuals (n = 70) using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). A continuous long-read library was prepared and sequenced using PacBio Sequel II technology by Berry Genomics (Berry Genomics Co ...
-
bioRxiv - Plant Biology 2023Quote: ... A final incubation with 70 µl proteinase K mixture (60 µl of proteinase K (Qiagen, cat no. 19131) and 420 µl of PKD buffer (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was harvested at 70% confluency or after differentiation using the RNEasy Mini kit (Qiagen #74104, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... ∼70 million colony forming units grown on the plates were collected and subjected to maxi-prep (Qiagen, 12362) to extract the barcode plasmid library ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Cell Biology 2021Quote: Antibodies and their conditions of use are as follows: mouse anti-His (Western blot, 1:1000; 34660; Qiagen), rabbit anti-Brl1 (Western blot ...
-
bioRxiv - Microbiology 2020Quote: 70 μL of sample inactivated by TRIzol LS was added to 280 μL of Buffer AVL (Qiagen, Hilden, Germany) with carrier RNA (Bennett et al ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA was precipitated with isopropanol and washed with 70% ethanol prior to its resuspension in EB buffer (Qiagen). DNA fragmentation and Illumina P7 adaptor (CAAGCAGAAGACGGCATACGAGAT ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA pellet was washed with 70% (v/v) ethanol and resuspended in 50 μL nuclease free water (Qiagen). DNA concentration and purity were determined by agarose gel electrophoresis and fluorometrically using RiboGreen (Qubit Assay Kit ...
-
bioRxiv - Genetics 2019Quote: ... mixed with 1 volume of 70% ethanol and then transferred to a RNeasy MinElute column (Qiagen, Hilden, Germany: 74204) for purification following the standard protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from 50-80 mg of surface-sterilised (70% EtOH, 0.1% Triton X-100) and 3-days germinated seeds with RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Isopropanol was removed and pellets were rinsed 2 times with 70% ethanol and left dry before solubilization with 35μL of EB buffer (Qiagen). The six samples were pooled together and purified ...
-
bioRxiv - Cell Biology 2020Quote: ... The aqueous phase was mixed with an equal volume of 70 % ethanol and transferred to a Rneasy Mini spin column (Qiagen). Total RNA was isolated with the Rneasy Mini Kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... The colorless phase was then collected and combined with equal volume of 70% ethanol and used as input in the RNeasy Micro kit (Qiagen), where we followed the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Four hundred µL of 70% ethanol were added and nucleic acid extraction was immediately done with the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was combined with equal parts of 70% ethanol and RNA was purified using an RNeasy Mini Kit (Qiagen). Equal amounts of RNA were reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Biorad) ...
-
bioRxiv - Genomics 2019Quote: ... We washed the pellets with 1 ml 70% ethanol and air dried before resuspending the libraries in EB buffer (Qiagen).
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted from 70 μL of supernatant using QIAamp 96 virus QIAcube HT kit on the QIAcube HT System (Qiagen). Each RNA sample was analyzed by one-step RT-qPCR with two SYBR Green assays ...
-
bioRxiv - Biochemistry 2021Quote: ... The aqueous phase was mixed with an equal volume of 70% ethanol and transferred to a RNeasy Mini spin column (Qiagen). The total RNA was isolated using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... the aqueous phase was added to an equal volume of 70% ethanol and used as the starting material for the RNeasy Mini Kit (74104, QIAGEN). RNA concentration and quality were assessed using a NanoDrop™ OneC Microvolume UV-Vis Spectrophotometer (840274200 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 µl of the upper phase were mixed with an equal volume of 70% EtOH and loaded on a RNeasy mini-kit column (Qiagen). After an on-column DNase treatment (RNase-free DNase set ...
-
bioRxiv - Neuroscience 2022Quote: ... For the other samples total RNA was mixed with an equal volume of 70% ethanol and further purified with miRNeasy Mini Kit (217004, Qiagen) using the manufacturer’s protocol (Supplementary Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 30 μl clarified lysate were mixed with 70 μl RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen) according the manufacturers recommendations ...
-
bioRxiv - Genomics 2020Quote: ... The lysate supernatant was mixed with an equivalent volume of freshly prepared 70% ethanol and purified using the RNeasy RNA isolation Kit (Qiagen). mRNA was extracted from approximately 5 μg of the total RNA samples using Sera-Mag oligo-dT beads (GE Healthcare Life Sciences) ...
-
bioRxiv - Systems Biology 2019Quote: ... 2i/LN511 or PDMK/LN511 conditioned cells at 70% confluency in a well of a 6-well plate using RNeasy Plus Mini (Qiagen). Three biological replicates were prepared ...
-
bioRxiv - Cancer Biology 2019Quote: ... the aqueous phase was combined with an equal volume of 70% ethanol and applied to a RNeasy Micro column (Qiagen) and processed as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... All samples were stored in 70% ethanol and DNA was extracted using QIAamp Fast DNA Stool Mini Kit (QIAGEN Germany) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The aqueous layer was then separated and washed with 70% ethanol and purified using the RNeasy Plus Mini Kit (Qiagen). The RNA was transcribed into cDNA and qPCR was performed using methods described (Dong et al ...
-
bioRxiv - Immunology 2022Quote: ... One volume of 70% ethanol was added and then transferred to a column from the RNeasy mini kit (Qiagen, 74104). RNA isolation was performed according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were combined with 400μl of 70% ethanol and loaded onto RNeasy mini columns (QIAGEN RNeasy Mini Kit, cat. 74104). RNA was extracted following the RNeasy protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... according to manufacturer instructions and the resultant aqueous phase was mixed (1:1) with 70% RNA-free ethanol and added to Qiagen Rneasy mini kit columns (Qiagen) and the kit protocol was followed ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from ∼70% confluent HeLa cells grown in 6-wells plate using a RNeasy Micro Kit (Qiagen) with a DNase step according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqueous phase was mixed 1:1 with 70% ethanol and applied to a minikit spin column and washed with RW1 and RPE buffer (Qiagen). cDNA was synthesized using the QuantiTect Rev ...
-
bioRxiv - Cell Biology 2023Quote: ... 600 uL) was mixed with an equal volume of 70% ethanol and loaded onto an RNA purification column (RNeasy, Qiagen). The purification was then carried out according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... according to manufacturer’s instructions and the resultant aqueous phase was mixed (1:1) with 70% RNA-free ethanol and added to Qiagen Rneasy mini kit columns (Qiagen) and the kit protocol was followed ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell sorting was carried out at the purity mode of sort precision using a low sheath pressure with a 70 μm nozzle and sorted cells were directly collected into ice-cold phenol and guanidine thiocyanate (QIAzol, QIAGEN) for subsequent RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... A volume of 1:1 of 70% ethanol was mixed with the upper phase before transfer on column (RNeasy Mini kit, Qiagen), and RNA was extracted according to manufacturer directions ...
-
bioRxiv - Genetics 2023Quote: ... DNA was digested on the column with 10 μL RNAse free DNase mixed with 70 μL RDD buffer (Qiagen, 79254) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqueous phase was added to an equal volume of 70% ethanol and transferred to a column from the RNeasy Mini Kit (74104, QIAGEN). The protocol for RNA extraction was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqueous phase was separated and added to an equal volume of 70% ethanol before using the RNeasy minikit (Qiagen) to isolate RNA following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Resulting DNA pellets were washed with 1.0 mL 70% ice-cold ethanol and re-suspended in 30 µL of EB buffer (Qiagen, Germany) after drying.
-
bioRxiv - Physiology 2024Quote: ... After chloroform incubation and centrifugation per manufacture instructions RNA-containing phase was diluted with 70% ethanol 1:1 and RNA isolation was performed using RNeasy Mini Kit (Qiagen). For tissues ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Genomics 2024Quote: ... The aqueous phase was then mixed with an equal volume of 70% ethanol and transferred to a silica column from the RNeasy Mini kit (Qiagen). Total RNAs were then purified according to the instructions of the manufacturer ...