Labshake search
Citations for Qiagen :
601 - 650 of 10000+ citations for Mouse N Myc Proto Oncogene Protein MYCN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified by Ni-NTA (Qiagen) and eluted with 300 mM Imidazole ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... For protein purification using NiNTA agarose (Qiagen), cells were lysed in 50 mM phosphate buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... and 20 µL Protein Kinase K (Qiagen) for 30 min at RT followed by the steps as described in the protocol of Dneasy Blood & Tissue Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from P15 liver tissue (n=4 biological replicates per strain) using QIAzol Lysis Reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... of vehicle and Acyl-GIP vehicle treated LDLR−/− mice (n = 5) using Qiazol according to the manufacturer’s instructions (Qiazol Lysis Reagent, QIAGEN). The quality of the RNA was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit ...
-
bioRxiv - Microbiology 2019Quote: Initial N-gene amplicon analysis was performed with 0.2 μl Round 2 product using the QIAxcel (Qiagen, Hilden, Germany). For positive reactions ...
-
bioRxiv - Microbiology 2020Quote: Following 72 h post treatment with a sublethal concentration of compound 33 (3.13 µM), adult male worms (n = 20 worms, three biological replicates) were homogenized with a TissueLyser (Qiagen) and total histones extracted using the EpiQuikTM Total Histone Extraction kit (OP-0006 ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from mouse forelimb buds and bamboo shark pectoral fin buds was extracted with the RNeasy Micro and Mini plus kit (QIAGEN, Cat. No. 74034 and 74134). Genomic DNA was removed with gDNA Eliminator columns included with this kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was precipitated in 80% ethanol and Automated Protein-Aggregation Capture (PAC) was performed on a BioSprint-96 (Qiagen) according to the following method ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... 12 WT littermates) and two-month-old mice (adult, n = 4 per group) were lysed and homogenized in QIAzol Lysis Reagent (Qiagen). Total RNA purification was performed with the miRNeasy Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... coli giant spheroplasts we used a N-terminally 6-His tagged version of TcMscS cloned into the expression plasmid pQE80 (Qiagen) with restriction sites BamHI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant proteins were then separated from the His-tagged TEV protease (and the cut N-terminal portion) by gravity-flow separation on Ni-NTA agarose (Qiagen). Finally ...
-
bioRxiv - Genetics 2020Quote: ... The supernatant of the transfected cells encoding for N-HIS-FAM19A5 was collected for Ni-NTA affinity chromatography (Qiagen, Germany). Purified N-HIS-FAM19A5 was then digested overnight at 30°C with AcTEV protease (Thermo Fisher Scientific ...
-
Single-cell assessment of trophoblast stem cell-based organoids as human placenta-modeling platformsbioRxiv - Developmental Biology 2022Quote: ... The methylation status of each CpG of interest (n=6 per sample) was evaluated with PyroMark Q-CpG software (Qiagen) and data from all CpG sites was averaged for each sample and presented as percent methylation (Figure S1E).
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
-
bioRxiv - Biochemistry 2024Quote: The periplasmically located VC0430 that was used for ESI-MS analysis was purified by applying the clarified lysate to N-NTA resin (Qiagen), washing the resin with Wash Buffer (WB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas3d and Cas10d proteins were purified from HEK293T cells expressing each His-tagged Cas protein using Ni-NTA agarose (Qiagen) and a gel filtration column (Superdex 200 increase 10/300 GL columns) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) and eluted using 300 mM imidazole in purification buffer ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were purified with Ni-NTA beads (Qiagen). Proteins and beads were washed 3 times with protein purification lysis buffer before incubating the beads with elution buffer (400 mM imidazole in protein purification lysis buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein was purified using Ni-NTA agarose (Qiagen) eluting with 300 mM imidazole ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins were purified with Ni-NTA Resin (Qiagen) using standard protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) resin first ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein Center (Thermo) and Ingenuity Pathways Analysis (Qiagen). For protein center analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Proteins were purified on Ni-NTA resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were purified using Ni-NTA agarose (QIAGEN), followed by size-exclusion chromatography using HiLoad 16/600 Superdex200 columns (GE Healthcare Life Sciences) ...
-
bioRxiv - Plant Biology 2023Quote: ... The proteins were purified using Ni-NTA (Qiagen), and the His tag was cleaved by the Tev protease ...
-
bioRxiv - Microbiology 2023Quote: ... SrtC2 protein was purified using Ni-NTA (Qiagen) affinity chromatography with the addition of 5 mM β-mercaptoethanol in all buffers ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with NiNTA agarose (Qiagen). The eluate was further purified over a Source 15 Q column (Cytiva) ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from batches of embryos, ICM or TE (n = 20) using PicoPur Arcturus (Excilone, France) with a DNase I (Qiagen, Germany) treatment as recommended by the supplier ...
-
bioRxiv - Biochemistry 2023Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...