Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA from mouse blood was extracted using a DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... L1-L5 mouse DRG was homogenized with an RNeasy Mini Kit (Qiagen, Valencia, CA) using on-column DNase-I digestion according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... spongiae DNA was extracted from mouse tissues using DNAeasy Blood and Tissue kit (Qiagen). The numbers of mice used in each individual experiment were calculated to permit detection of at least a two- to four-fold difference in bacterial loads between groups with 95% (two-sided ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted from mouse islets using the RNAeasy Micro Kit (QIAGEN, Cat # 74004); RNA was extracted from flash-frozen liver and peripancreatic fat tissues using TRIzolTM (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was purified from mouse tissues using the RNeasy Plus Mini Kit (Qiagen) and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated from cell pellets using a genomic DNA isolation kit (Blood & Cell Culture Midi kit (Qiagen)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... mixed D1R and D5R-specific siRNA (#SI00015792, #SI00015869, Qiagen Science Inc., Germantown, MD) or non-silencing “mock” siRNA ...
-
bioRxiv - Plant Biology 2020Quote: ... using gene-specific primers (Table S1) by employing a Rotor-Gene Q6000 (Qiagen). qPCR conditions were composed of three steps of cycling ...
-
bioRxiv - Microbiology 2021Quote: ... The AllStars negative control siRNA was used as a non-specific control (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: A Wnt-specific TCF/LEF-driven reporter plasmid was used (Qiagen, Valencia, CA). The C2C12 cells were trypsinized and seeded in triplicate wells at 50,000 cells/well in 12-well plates on day 1 ...
-
bioRxiv - Biophysics 2020Quote: ... Real-Time PCR was performed with specific primers purchased from Qiagen (Tables 1,2) and Power SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... specific siRNAs (SI02225825 for PPP2R2A and SI02759148 for PPP2R2D)) were purchased from Qiagen. ON-TARGET plus SMARTpool siRNAS against human ENSA (L-011852-00 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and qPCR was performed using gene specific QuantiTect Primer Assay primers from Qiagen. Relative expression levels were normalized to gapdh expression according to the formula <2^− (Ct gene of interest − Ct gapdh ...
-
bioRxiv - Cell Biology 2021Quote: ... The AllStars Negative Control siRNA and gene-specific siRNAs were purchased from Qiagen and Eurofinns ...
-
bioRxiv - Cancer Biology 2020Quote: ... and internal control EIF3D and RPL13A specific primers (RT2 qPCR Primer Assays -Qiagen) and RT² SYBR® Green qPCR master mix using the recommended protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the respective Quantitect Primer pairs for detection of specific mRNAs (Qiagen, Hilden, Germany), and StepOnePlusTM qPCR system (2-ΔΔCT method) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Specific primer pairs (miScript Primer Assay or miRCURY LNA miRNA PCR Assay, Qiagen) for miR-142-5p and RNU48 were used ...
-
bioRxiv - Plant Biology 2023Quote: ... using specific primers (Supplemental Table 1) in a Rotor-Gene Q machine (Qiagen). Standard curves were achieved by dilutions of one cDNA sample ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected with either 100 nM of the specific YTHDF1 siRNA (SI00764715, Qiagen) or 100 nM siGENOME non-targeting siRNA (Dharmacon ...
-
bioRxiv - Cell Biology 2023Quote: ... specific siRNAs (SI02225825 for PPP2R2A and SI02759148 for PPP2R2D) were purchased from Qiagen and transfected using Hiperfect (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products from reactions producing a specific fragment underwent PCR clean-up (Qiagen) and ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific siRNA oligonucleotides for β-catenin and control siRNA were obtained from Qiagen, Caveolin-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transiently transfected with mammalian protein expressing plasmids using Effectene (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A2 and B Wolbachia using PyroMark Assay Design 2.0 (Qiagen, USA). A complete list of primers sequences could be found in Table S3 ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Immunology 2022Quote: ... for cell fractions ≥0.2×106 cells and the RNeasy Micro Kit (Qiagen) for fractions ≤0.2×106 cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein was extracted using a modification of the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The extraction was carried out using the AllPrep Bacterial DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Protein purification was carried out using QIAExpressionist NiNTA purification kit according manufacturer’s instructions (Qiagen, Germany) and following the HIS purification under native conditions protocol ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted from fetal tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) and bisulfite conversion was carried out using EZ DNA Methylation Kits (Zymo Research) ...
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using a commercial kit (Qiagen Buccal Cell and DNAeasy Kit), as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: DNA and RNA were extracted from cells using either Blood & Cell Culture DNA Mini Kit and RNAeasy isolation kit (Qiagen), or all-prep DNA/RNA kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted from mouse testes using an RNeasy Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: Genomic DNA was isolated from mouse tail tissue using DNeasy Blood and Tissue Kits (Qiagen) following digestion with proteinase K ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from frozen mouse skin tissues using the RNeasy Plus kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was purified from laser-microdissected mouse SCN using the RNeasy Micro Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from mouse urothelium was obtained using the RNeasy mini kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... genomic DNA was isolated from mouse tails using DNeasy Blood and Tissue Kit (Qiagen, #69506). PCR was carried out using Econo-Tag Plus Green 2x master mix and the following primers ...
-
bioRxiv - Neuroscience 2021Quote: RNA from bulk mouse brain tissue was extracted using the RNeasy Plus Mini Kit (Qiagen) and resuspended in nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from adult mouse hippocampal tissue using an RNeasy Plus Kit (Qiagen). Amplification of 5’ cDNA ends was performed using the GeneRacer™ Kit (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: Mouse lungs were homogenized and RNA was extracted using the Qiagen RNeasy Mini Kit (Qiagen). Extracted RNA was used for cDNA synthesis using Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2019Quote: Total islet RNA (100–200 islets/mouse) was extracted using the RNeasy Mini Kit (Qiagen). RNA concentration and integrity were assessed using the ND-1000 Spectrophotometer (NanoDrop) ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from distinct mouse brain regions using the RNeasy Mini Kit (QIAGEN). The QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Microbiology 2019Quote: ... mouse faecal samples were extracted with the QIAamp DNA FAST Stool Mini Kit (QIAGEN, Germany) (Lim et al. ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from mouse skin-punch biopsies using the DNeasy tissue kit (QIAGEN, #69506) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... paraffin-embedded (FFPE) stomach sections per mouse using the AllPrep DNA/RNA FFPE Kit (Qiagen) and gene expression was detected using the nCounter Mouse Immunology Panel (NanoString) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was isolated from mouse retinas or from HRMEC culture with RNeasy Kit (Qiagen) based on manufacturer protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... adipocytes and mouse adipose tissue RNeasy Lipid Tissue Mini Kit was used (Qiagen, cat. 74804) following manufacturer instruction ...