Labshake search
Citations for Qiagen :
451 - 500 of 10000+ citations for Mouse Histamine N Methyltransferase HNMT ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... 12 WT littermates) and two-month-old mice (adult, n = 4 per group) were lysed and homogenized in QIAzol Lysis Reagent (Qiagen). Total RNA purification was performed with the miRNeasy Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Pathology 2022Quote: ... The N gene-specific primers were used to amplify 97 bp of SARS-CoV-2 N gene by conventional PCR and purified by Qiagen gel extraction kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... coli giant spheroplasts we used a N-terminally 6-His tagged version of TcMscS cloned into the expression plasmid pQE80 (Qiagen) with restriction sites BamHI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant proteins were then separated from the His-tagged TEV protease (and the cut N-terminal portion) by gravity-flow separation on Ni-NTA agarose (Qiagen). Finally ...
-
bioRxiv - Genetics 2020Quote: ... The supernatant of the transfected cells encoding for N-HIS-FAM19A5 was collected for Ni-NTA affinity chromatography (Qiagen, Germany). Purified N-HIS-FAM19A5 was then digested overnight at 30°C with AcTEV protease (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... membranes were solubilized in 1.2% N-decyl-β-maltoside (DM) and the protein was purified on a Ni-NTA affinity column (Qiagen). Following His-tag removal ...
-
Single-cell assessment of trophoblast stem cell-based organoids as human placenta-modeling platformsbioRxiv - Developmental Biology 2022Quote: ... The methylation status of each CpG of interest (n=6 per sample) was evaluated with PyroMark Q-CpG software (Qiagen) and data from all CpG sites was averaged for each sample and presented as percent methylation (Figure S1E).
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Biochemistry 2024Quote: The periplasmically located VC0430 that was used for ESI-MS analysis was purified by applying the clarified lysate to N-NTA resin (Qiagen), washing the resin with Wash Buffer (WB ...
-
bioRxiv - Physiology 2023Quote: ... the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from batches of embryos, ICM or TE (n = 20) using PicoPur Arcturus (Excilone, France) with a DNase I (Qiagen, Germany) treatment as recommended by the supplier ...
-
bioRxiv - Biochemistry 2023Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal mouse Strep-tag antibodies (#34850, Qiagen), a monoclonal anti-actin antibody (A5441 ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA for Anxa2 (Mouse, Qiagen, Mm_Anxa2_3, SI00167496).
-
bioRxiv - Biochemistry 2023Quote: Mouse EL4 genomic DNA was isolated by QIAGEN Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse tissues were homogenized using TissueLyser II (Qiagen) and stainless-steel beads (5 mm ...
-
bioRxiv - Neuroscience 2020Quote: ... from APP/PS1 and NTG mice treated with vehicle of CP2 for 14 months (n = 5 per group) were lysed in QIAzol (Qiagen cat. # 79306) followed by RNA isolation using miRNeasy (Qiagen cat ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Cell Biology 2019Quote: ... coli as an N-terminal histidine-tagged protein isolated from cell lysate after passage through Ni-NTA agarose (Qiagen, Cat. No. 30210). Bound TTRL55P was then eluted by competition with imidazole ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA from honey bees was isolated from the abdomen of individual bees after homogenization in 200 μl of Trizol reagent using the TissueLyser LT (Qiagen N. V.) for 3 min ...
-
bioRxiv - Cell Biology 2019Quote: ... the mouse anti-penta-His antibody (Qiagen; Catalog #34660) was used at a 1:2,000 dilution in 3% BSA in PBS with sodium azide ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Biophysics 2019Quote: ... Biotinylated mouse anti-5xHis antibody was purchase from QIAGEN. Mouse anti Tubulin beta 3 antibody from BioRad (Hercules ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or mouse anti-RGS-His antibody (Qiagen; cat # 34610) at 1:5000 dilution followed by goat anti-rabbit-HRP conjugate (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... and RT2 profiler PCR Arrays: Mouse Antiviral response (Qiagen). Data analyses were performed using the GeneGlobe (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: Mouse MSCs RT2 Prolifer PCR array (PAMM-084ZG, Qiagen) was used to evaluate the expression of 84 specific genes related to autophagy using manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-penta-His antibody (34660; Lot# 136244018; Qiagen); mouse anti-Myc tag mAb ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse tissue was homogenised with a TissueLyser II (Qiagen) at 30 Hz for 60 seconds ...
-
bioRxiv - Immunology 2022Quote: ... RT2 Profiler™ PCR array mouse cytokines & chemokines (Qiagen) was used according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Whole mouse kidneys were homogenized in lysis buffer (Qiagen) and total RNA was extracted from a portion of the lysate using RNeasy Mini kit ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted using the FFPE GeneRead DNA Kit which incorporates enzymatic cleavage of DNA at uracil residues via uracil DNA glycosylase reducing the problem of cytosine deamination (Qiagen, cat n. 180134) according to manufacturers’ instructions ...
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...
-
bioRxiv - Microbiology 2019Quote: ... kit (Qiagen). Phylogenetic groups were determined as described in (Clermont ...
-
bioRxiv - Microbiology 2019Quote: ... Kit (QIAGEN) followed with 16S-ITS PCR as previously described (64 ...
-
bioRxiv - Genetics 2020Quote: ... Kit (QIAGEN) according to the manufacturer’s protocol ...