Labshake search
Citations for Qiagen :
101 - 150 of 2379 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and virus RNA was purified by using the QIAamp viral RNA kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was extracted from the virus preparation using the RNeasy kit (Qiagen). The first cDNA strand corresponding to the entire 10 kb-long genomic RNA was produced using Superscript III Reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from virus stock using QIAamp Viral RNA Mini Kit (Qiagen) and treated with TURBO DNase (Ambion) ...
-
bioRxiv - Immunology 2019Quote: Viral RNA was isolated from virus particles with RNeasy-Kit (Qiagen, Valencia, CA). Access RT-PCR kit (Promega ...
-
bioRxiv - Neuroscience 2020Quote: SIV RNA was measured by qRT-PCR using the QuantiTech Virus Kid (Qiagen) and the following primers and probes in the SIV gag region (Fwd ...
-
bioRxiv - Microbiology 2020Quote: ... RNA of single virus clone was extracted by Viral RNA Mini Kit (QIAGEN) and reversely transcribed using PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa ...
-
bioRxiv - Microbiology 2020Quote: ... virus media was removed and cells were harvested using RNAprotect Cell Reagent (Qiagen). RNA was extracted using RNeasy columns (Qiagen ...
-
Genetic heterogeneity in the Salmonella Typhi Vi capsule locus: A population genomic study from FijibioRxiv - Microbiology 2023Quote: ... DNA was extracted using a QIAsymphony DSP virus pathogen kit (Qiagen, Maryland, USA). Genome sequencing was performed using Illumina Nextera XT (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA from virus-infected cells was extracted using the RNeasy kit (Qiagen) or Isolate II RNA mini kit (Bioline) ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2021Quote: Bacterial DNA was extracted from human and mouse feces-derived bacterial supernatant using the DNeasy powersoil kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total RNAs from HC69 or HIV-infected IMG cells with different treatments were isolated by using the RNeasy Plus Mini kit from Qiagen (Cat#74134). The purified total RNAs were converted to first-strand cDNAs by using a reverse transcription kit (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: HCV and HIV RNA were extracted from 200 μL plasma using a QIA amp® Viral RNA Mini Kit (QIAGEN, Hilden, Germany) according to the manufacture’s instruction and 50 μL of eluted RNA was stored at −70 °C until use ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Memorial Sloan Kettering Cancer Center) at a dilution of 1:5,000) and His (mouse anti-penta-His antibody (Qiagen, cat. #34660) at a dilution of 1:10,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Viral RNA was isolated using the QIAamp MinElute Virus Spin Kit (Qiagen, Germantown, MD), omitting carrier RNA ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from 200µl serum using the EZ1 Virus Mini Kit v2.0 (Qiagen), and viral load determined by Artus HBV PCR kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2020Quote: RNA extracts in which the virus was detected were DNAse I treated (Qiagen, Germany) for 15 min at room temperature prior to sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was isolated using the QIAamp MinElute Virus Spin Kit (Qiagen, Germantown, MD), omitting carrier RNA ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was extracted from virus supernatants using the QIAmp Viral RNA kit (Qiagen, UK) as described by the manufacturer (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA from the NPA was extracted using EZ1 Virus Mini Kit v2 (Qiagen [955134]). The RNA concentration was measured by the Qubit RNA BA assay (Qiagen [32852]) ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was extracted from virus-infected cells using an RNeasy Mini Kit (Qiagen). For PB2 ...
-
bioRxiv - Microbiology 2020Quote: ... nasal swab samples or cell cultured virus isolates by RNeasy Mini Kit (QIAGEN, Denmark) automated on the QIAcube (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from 100 μl of the virus stock using RNeasy kit (Qiagen) and analyzed by RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... rAAV genomes were extracted and purified using a QIAamp MinElute Virus Spin kit (Qiagen) and titered by qPCR with serial dilutions of a plasmid standard ...
-
bioRxiv - Genomics 2022Quote: ... DNA was then extracted immediately with QIAamp UltraSens Virus Kit (QIAGEN, Cat. No. 53706). The manufacturer’s instructions were followed with the first six steps replaced by combining 140 μL of sample with 5.6 μL carrier RNA and vortexing briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked with 5% milk in PBST (Phosphate buffer saline, 0.05% Tween 20) and incubated with monoclonal mouse anti-His antibody (Penta His, Qiagen, dilution 1:1000) according to the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA from these samples was obtained with the QIAamp Mini Elute Virus Spin Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was extracted from each sample using QIAgen DSP virus/pathogen Midi kits (QIAGEN) on a QIASymphonyXP laboratory automation instrument platform ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from 200 μL of specimen using the EZ1 DSP Virus kit (Qiagen) on the EZ1 Advanced XL instrument (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: Tissue homogenates for virus titration were generated using the Tissue Lyzer II (Qiagen, Gaithersburg, MD). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qRT-PCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted from virus stocks using the Qiagen Viral RNA Mini Kit (Qiagen) and was used as a template for multi-segment RT PCR as described previously (31) ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Samples for analysis of virus attachment were directly collected by incubating in RLT buffer (Qiagen) for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extraction was performed on the QIAsymphony using the DSP Virus/Pathogen Mini Kit (Qiagen). Library preparation performed using Nextera XT (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: Viral genomic RNA was isolated from concentrated virus stocks with viral RNA isolation kit (Qiagen). RNA was treated with Turbo DNase and inactivation beads (Ambion) ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen, Toronto, ON, Canada). Then ...
-
bioRxiv - Biochemistry 2023Quote: ... and mouse anti-Phospho-Serine Q5 (catalogue number: 37430) was from Qiagen. Horseradish peroxidase-conjugated secondary antibodies against rabbit (catalogue number ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...