Labshake search
Citations for Qiagen :
351 - 400 of 1787 citations for Mouse Anti Herpes Simplex Virus Type 2 Antibody HSVA33 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA of PDOs grown in ‘Type 1’ culture medium was isolated according to the manufacturer’s protocol using the RNeasy Mini Kit (QIAGEN). Quality and quantity of the RNA samples and the libraries were measured with Agilent’s Bioanalyzer2100 and Invitrogen™ Qubit™ 3.0 Fluorometer ...
-
bioRxiv - Immunology 2021Quote: The indicated cell types were harvested and stored at −80°C until RNA was isolated using RNeasy kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: dram1 or dram1Δ19N (negative control) RNA was isolated from wild type or dram1Δ19n/Δ19n embryos using QIAzol lysis reagent (79306, QIAGEN) and purified with the RNeasy MinElute Cleanup kit (74204 ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was isolated from wild type and auts2ancb104 heterozygote and homozygote embryos using an RNeasy Mini kit (QIAGEN), and first-strand cDNA was synthesized from 1 ⎧g of total RNA by oligo(dT ...
-
bioRxiv - Genomics 2021Quote: RNA was extracted from validated clones and wild-type HAP1 cells using the RNeasy Mini Kit (Qiagen cat # 74104) following the manufacturer’s instructions and then treated with TURBO DNA-free™ Kit (Life Technologies cat # AM1907 ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with wild-type CrPV or CrPV-DcDV RNA using the TransMessenger transfection reagent (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and the transfected cells were incubated at 26 °C ...
-
bioRxiv - Genetics 2020Quote: ... and cells treated with transfection mix without siRNA (Wild type (WT)) or non-targeting control siRNA (scrambled (SCR)) (Qiagen catalog SI03650318 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA and RNA were extracted from the B14804-/- and wild-type cells using AllPrep DNA/RNA Mini kit (Qiagen). cDNA was synthesized from extracted RNA using SuperScript™ III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... rdr1;2;6 Cen5-ATHILA5 ddm1 (hp5) and their corresponding DDM1 wild-type siblings with the DNeasy Plant Pro Kit (Qiagen). From each sample ...
-
bioRxiv - Microbiology 2023Quote: ... oxydans wild-type cultures at OD600 0.3 units (Exp) or 3 units (Sta) using the RNeasy Mini Kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Neuroscience 2021Quote: ... allowing resolution of a 230-bp product for the wild-type allele and a 194-bp product for the mutant allele (DNeasy 96 Blood and Tissue Kit, Qiagen).
-
bioRxiv - Genomics 2022Quote: ... The genomic DNA of the wild-type and the mutant strains was isolated using a QIAamp DNA Mini Kit (QIAGEN). Libraries were prepared using the Nextera XT DNA Library preparation kit (Illumina) ...
-
bioRxiv - Genomics 2020Quote: Thirty-three RNA samples were extracted from three biological replicates of each of 11 diverse tissue types of A188 with RNeasy Plant Mini Kit (Qiagen) (Supplementary Table 10) ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentivirus carrying the response elements for type I (ISRE - #CLS-008L-1) or type II (GAS - #CLS-009L-1) upstream of firefly luciferase was purchased from Qiagen. Twenty-four hours post plating ...
-
bioRxiv - Developmental Biology 2020Quote: ... ∼100 ng of total RNA from each cell type was used as input to generate miRNA sequencing libraries using a QIAseq miRNA library kit (Qiagen). Single-end 100 bp reads (1×100 ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified using 96-well PCR array analysis on a PAMM-150ZA plate (Cytokines & Chemokines) and PAMM-016ZA plate (Type I Interferon Response) (both Qiagen). Quantitative real time-PCR (QRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted from 5-day-old wild-type and Mpatg mutant thalli using the RNeasy Plant Mini Kit (Qiagen) and used as a template for reverse transcription using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ES2 human clear cell carcinoma cells present (wild type) or absent (siRNA) ARID1A were collected and extracted using an RNeasy Plus Micro Kit (Qiagen). Barcoded TruSeq RNA v2 libraries (Illumina ...
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from a wild type clone and a mutant using a QIAGEN Plasmid Midi Kit (Qiagen, Tokyo, Japan) and used as standard DNA to determine ratios of mosaicism ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pathway analysis of genes adjacent to identified tissue and cell-type specific methylation blocks was performed using Ingenuity Pathway Analysis (IPA)(42) (Qiagen) and Genomic Regions Enrichment of Annotations Tool (GREAT)(43) ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from 20 trunks of either E8.5 wild-type or Aldh1a2-/- embryos with the RNeasy Micro Kit (Qiagen #74004). Reverse transcription was performed with the High-Capacity cDNA RT Kit (Thermo Fisher Scientific #4368814) ...
-
bioRxiv - Genomics 2019Quote: ... and two control bulls that were homozygous for the wild type allele was extracted from testis tissues using the RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: DNA extraction was done from 1 ml of the different sample types using QIAamp DNA mini kit (Qiagen, Hilden, Germany), as per the vendor’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from wild-type and ΔTMPRSS2 293T cell lines using the Puregene cell kit according to the manufacturer’s instructions (Qiagen, #158388). Co-transfection of pJC144 (guide 1 ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction from cultured tprAko-SS14 or wild-type strains propagated in 6-well plates following the transformation procedure was performed using the QIAamp mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from one wild-type control and three patient cell lines using DNeasy Blood and Tissue kit (Qiagen). Specific primers were designed to cover approximately 500 base pairs around the mutations and the regions were PCR-amplified using Qiagen Multiplex PCR kit (Qiagen) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... with tissue homogenization being performed using a rotor stator type tissue homogenizer (ProScientific Bio-Gen PRO200 Homogenizer; Multi-Gen 7XL Generator Probes) in RLT Buffer (Qiagen). RNA quality was assayed using a nanodrop ...
-
bioRxiv - Genetics 2022Quote: Total RNA was isolated from 50 to 100 μl of packed worms from wild type and brd-1(null) using the RNeasy Mini Kit (74104; Qiagen) and QIAshredder (79654 ...
-
bioRxiv - Neuroscience 2022Quote: Brain and spinal cord tissue from Prp-TDP43A315T (Tg) animals and wild type (Wt) littermates were homogenized using a TissueRuptor (Qiagen). 1 mL of TRIzol per 250 mg of tissue was used for homogenization and RNA was isolated as per the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... cf-DNA quantified from various plasma or serum types using either MitoQuicLy or a silica-based membrane column DNA extraction kits (DNeasy, Qiagen). A total of 50 samples were analyzed (5 biofluids ...
-
bioRxiv - Biochemistry 2023Quote: ... A linearized PCR template was generated by digesting a wild-type Hrd1 plasmid with restriction enzyme and purified using a QIAquick PCR purification kit (Qiagen). For each region two separate PCR reactions were set up ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from adult ovaries of transgenic or wild-type zebrafish using the RNeasy Mini kit (QIAGEN, 74134) and reverse-transcribed using SuperScript IV reverse transcriptase (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA from HeLa cells transfected with either wild-type PADI2 (WT) or mutant PADI2 (with L642A, or L642A/W161A, or L642A/W161A/T159A) was extracted using RNeasy (Qiagen) according to the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pathway analysis of genes adjacent to identified tissue and cell-type specific methylation blocks was performed using Ingenuity Pathway Analysis (IPA) (Qiagen) (90).
-
bioRxiv - Molecular Biology 2024Quote: RNA isolation from leaf tissues of five-week-old non-transformed wild type and overexpressing transgenic lines (two replicates of wild type and two transgenic lines) were isolated as per manufacturer’s instruction (Qiagen, Germany). High quality RNA samples with 200 ng/μL concentration were outsourced for RNA-seq ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was isolated from two-week-old Villersexel wild type and the nog1dis mutant using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... The peptide spot membrane was blotted onto a nitrocellulose membrane and UNC-45 binding was probed with an anti-Strep antibody (Qiagen) using an ECL-kit for detection (GE Healthcare).
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...