Labshake search
Citations for Qiagen :
301 - 350 of 1363 citations for Mouse Anti Hepatitis C Virus NS4b Antibody 1858 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Serum was stored at −80°C as well as tissue samples were stored at −80°C or in RNAlater (Qiagen, Hilden, Germany) at −20°C.
-
bioRxiv - Plant Biology 2022Quote: Total root RNA was extracted from plantlets grown in vitro at 22 °C and 10 °C using the RNeasy®Plant Mini Kit (QIAGEN, Germany). One microgram of total RNA was reverse transcribed using an oligo(dT)20 primer and the Super Script™ IV RT (lnvitrogen,USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... The peptide spot membrane was blotted onto a nitrocellulose membrane and UNC-45 binding was probed with an anti-Strep antibody (Qiagen) using an ECL-kit for detection (GE Healthcare).
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was prepared from day one adult animals raised at 25°C or 20°C by using RNeasy® Mini Kit (Qiagen, Venlo, The Netherlands). endu-2(tm4977 ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... Mouse and viral DNA were isolated from mouse tissue using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). iTAQ universal Syber Green supermix (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli C mutants was extracted using DNeasy Blood & Tissue kit (Qiagen). Quality of extracted DNA was confirmed before sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... For the detection of phosphorylated Serine residues a TBS solution with a 1:100 dilution of the Anti-Phospho-Serin Antibody (Qiagen, Hilden, Germany) was used ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Plin2 homology arms were obtained by extracting DNA from mouse primary mouse NSPCs from the SVZ using DNeasy Blood & Tissue Kit (#69506, Qiagen). The sequences covering the sgRNA target site were extracted from the genomic DNA using PCR ...
-
bioRxiv - Genomics 2022Quote: ... The DNA from mouse bladder tumors and matched germline DNA from mouse tails were extracted using the DNeasy Blood Tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated with primary antibody (Penta·His Antibody, QIAGEN®, 1:2000 dilution) in 1% bovine serum albumin in PBST for 2h at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... for mouse cells or the RNeasy kit (Qiagen) for human cells ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA for Anxa2 (Mouse, Qiagen, Mm_Anxa2_3, SI00167496).
-
bioRxiv - Biochemistry 2023Quote: Mouse EL4 genomic DNA was isolated by QIAGEN Blood & Cell Culture DNA Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse tissues were homogenized using TissueLyser II (Qiagen) and stainless-steel beads (5 mm ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... overnight at 37 °C and purified by a PCR purification kit (Qiagen). Subsequently ...
-
bioRxiv - Neuroscience 2020Quote: ... at −80°C until RNA extraction using the RNeasy Mini Kit (Qiagen). RNA quality was determined using the RNA nano assay on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...