Labshake search
Citations for Qiagen :
501 - 550 of 2117 citations for Mouse Anti Hepatitis C Virus Core Protein Antibody 1862 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... The peptide spot membrane was blotted onto a nitrocellulose membrane and UNC-45 binding was probed with an anti-Strep antibody (Qiagen) using an ECL-kit for detection (GE Healthcare).
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins from HGCC cells and GBM tissue were extracted with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Neuroscience 2019Quote: ... RNA and protein were extracted for ECM composition analysis using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). RNA was processed with the QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2019Quote: ... To summarize the cellular locations and protein classes the protein list was annotated using Ingenuity Pathway Analysis (Qiagen).
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was prepared from day one adult animals raised at 25°C or 20°C by using RNeasy® Mini Kit (Qiagen, Venlo, The Netherlands). endu-2(tm4977 ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 250 μl of Protein Precipitation Solution (QIAGEN) was added to each sample and were incubated on ice for 5 min followed by vigorous vortexing for at least 30 sec ...
-
bioRxiv - Molecular Biology 2021Quote: ... For protein purification Ni-NTA agarose (Qiagen) was used ...
-
bioRxiv - Genomics 2020Quote: ... 333 μL of Protein Precipitation Solution (Qiagen) was added to each sample which was then vortexed and then centrifuged at 2000 x g for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified by Ni-NTA (Qiagen) and eluted with 300 mM Imidazole ...
-
bioRxiv - Cell Biology 2021Quote: AllPrep DNA/RNA/Protein Mini Kits (Qiagen) were used to extract total proteins from UVA-exposed and non-exposed HTEpC from all experiments ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... For protein purification using NiNTA agarose (Qiagen), cells were lysed in 50 mM phosphate buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... and 20 µL Protein Kinase K (Qiagen) for 30 min at RT followed by the steps as described in the protocol of Dneasy Blood & Tissue Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was precipitated in 80% ethanol and Automated Protein-Aggregation Capture (PAC) was performed on a BioSprint-96 (Qiagen) according to the following method ...
-
bioRxiv - Immunology 2022Quote: ... Mouse and viral DNA were isolated from mouse tissue using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). iTAQ universal Syber Green supermix (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... α-His antibody (Qiagen) was used at 1:5,000 dilution to detect the presence of rRH5 in Native-PAGE.
-
bioRxiv - Physiology 2019Quote: ... as well as mouse Tbp (Quantitect, Qiagen) as a housekeeping gene.
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse XpressRef Universal Total RNA (QIAgen, 338114) was reverse transcribed and used at a concentration of 250 ng cDNA per reaction as a positive control for each primer set ...
-
bioRxiv - Bioengineering 2021Quote: Cells were lysed for total protein in 96-well format using the Qproteome Mammalian Protein Prep Kit (Cat. 37901, Qiagen). Protein lysates were loaded onto and analyzed using the WesTM (ProteinSimple ...
-
bioRxiv - Cell Biology 2020Quote: DNA and proteins were extracted from approximately 30 of quadriceps muscles using AllPrep DNA/RNA/Protein Mini kit (#80004, Qiagen). DNA concentrations were determined by Thermo Scientific NanoDrop 2000c spectrophotometer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas3d and Cas10d proteins were purified from HEK293T cells expressing each His-tagged Cas protein using Ni-NTA agarose (Qiagen) and a gel filtration column (Superdex 200 increase 10/300 GL columns) ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and proteins were extracted from these individuals using the AllPrep DNA/RNA/Protein Mini Kit (Cat. No. 80004, Qiagen). RNA libraries were constructed for these individuals at Novogene ...
-
bioRxiv - Bioengineering 2023Quote: ... and protein were collected from tissues using the AllPrep DNA/RNA/protein Mini Kit (QIAGEN, Venlo, the Netherlands, CAT# 80004) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA and proteins were extracted from the four individuals using the AllPrep DNA/RNA/Protein Mini Kit (Cat. No. 80004, Qiagen). DNA libraries were constructed for these six individuals at HyLabs ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... coli C mutants was extracted using DNeasy Blood & Tissue kit (Qiagen). Quality of extracted DNA was confirmed before sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) and eluted using 300 mM imidazole in purification buffer ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were purified with Ni-NTA beads (Qiagen). Proteins and beads were washed 3 times with protein purification lysis buffer before incubating the beads with elution buffer (400 mM imidazole in protein purification lysis buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein was purified using Ni-NTA agarose (Qiagen) eluting with 300 mM imidazole ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins were purified with Ni-NTA Resin (Qiagen) using standard protocols ...
-
bioRxiv - Cancer Biology 2020Quote: The All Prep DNA/RNA/Protein kit (QIAGEN) was used to total RNA from cell lines ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) resin first ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein Center (Thermo) and Ingenuity Pathways Analysis (Qiagen). For protein center analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Proteins were purified on Ni-NTA resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The proteins were purified using Ni-NTA (Qiagen), and the His tag was cleaved by the Tev protease ...