Labshake search
Citations for Qiagen :
1 - 50 of 2120 citations for Mac 1 SAP mouse human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... SHP1 and SAP were purchased from QIAGEN (Hilden, Germany) (siSLAMF6(1 ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Plant Biology 2023Quote: ... Mesophyll sap was rapidly collected and deposited into RLT lysis buffer for RNA extraction (RNeasy Plant Mini Kit, Qiagen). Excess moisture was removed of the purified bundle sheath strands on a bed of paper towel ...
-
bioRxiv - Immunology 2024Quote: ... Immature (CD24high) thymocytes from both B6 and B6.SAP-/- mice were sorted directly into 350 microliters of RLT lysis buffer (Qiagen). RNA was extracted using the RNeasy Micro kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Genomics 2019Quote: We analyzed human and mouse Tug1 cDNA sequences with CLC Genomics Workbench (Qiagen) for open reading frames (ORFs) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA from MACS-purified cells was extracted using QIAshredder and RNeasy protocols (Qiagen). cDNA was amplified by Single Primer Isothermal Amplification (Ribo-SPIA® technology ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from MACS sorted neurons (see above) using the RNeasy Micro Kit (Qiagen, 74004) following the manufactureŕs instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Two mouse and two human stool samples were homogenized using a PowerLyzer 24 Homogenizer (110/220V; Qiagen). DNA was extracted using four different bead beating times ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet was lysed using RLT buffer (mouse cells) or QIAZol (human cells) (Qiagen, Cat. 79306). RNA was extracted using the Qiagen RNeasy micro kit.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Immunology 2022Quote: ... MACS or FACS purified CD1c+ cells were immediately taken up in a lysis buffer (RLT plus, Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Genomics 2021Quote: ... One section was added to a MACs M tube (Miltenyi Biotech, U.K.) containing 1ml Qiazol (Qiagen, U.K.) and dissociated on a GentleMACs (Miltenyi Biotech ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from MACS-sorted splenic B cells with the RNA Mini Kit (Qiagen, Hilden, Germany). Quantification of RNA was performed with a NanoPhotometer (Implen ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: The total RNA from mouse cortex and human PBMC was extracted using the RNeasy® Mini Kit (Qiagen) and real-time PCR was done as described in the Supplementary material.
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: Microdissected mouse and human brain tissue was flash frozen and homogenized in Trizol using a TissueLyser II (Qiagen). Phenol chloroform extraction was then used together with the RNeasy mini kit (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from FACS/MACS-isolated CD8+ T cells and reverse-transcribed using RNeasy Micro Kit (Qiagen) and SuperScript™ IV VILO™ Master Mix with ezDNase™ Enzyme (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: Bacterial DNA was extracted from human and mouse feces-derived bacterial supernatant using the DNeasy powersoil kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... as described previously.21 Lymphocytes were then purified using MACS LS Columns per the manufacturer’s instructions and sorted on the iCyt Synergy (Sony) into Buffer RLT (Qiagen). RNA was next extracted using the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from MACS-isolated whole-cortex microglia using the RNeasy Micro Kit per manufacturer instructions (Qiagen, Cat # 74004) and quantified on a NanoDrop 2000 (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...