Labshake search
Citations for Qiagen :
451 - 500 of 1323 citations for L Phenylalanine N T Boc 2 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of HiPerfect transfection reagent (cat. no. 301705, Qiagen) were mixed with 100 μL NeuroBasal medium without supplements ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Biochemistry 2023Quote: ... then loaded on to 2 mL Ni-NTA column (Qiagen) pre-equilibrated with 10 column volumes of 50 mM Tris pH 7.5 containing 300 mM NaCl ...
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...
-
bioRxiv - Immunology 2023Quote: ... following a 2-step VDJ amplification using HotStarTaq Plus (Qiagen). PCR products were enzymatically cleaned again and illumina adapters and indexes were introduced via PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was incubated with 2 mL Ni-NTA (Qiagen) for 1 hour at 4°C with gentle mixing ...
-
bioRxiv - Genomics 2020Quote: ... The 96-well plates contained 12μl per well of reverse cross-linking buffer (0.83 mg/ml Proteinase K and 0.042% SDS in Qiagen EB buffer), and were put on ice ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 18 cultures that were growing in LB+colistin (2mg/L) using DNeasy Blood and Tissue Kit (QIAGEN)
-
bioRxiv - Genomics 2022Quote: ... 100 µl of lysis buffer was added to each 5mm punch biopsy and subjected to lysis using the TissueLyser II (Qiagen), at speed of 30 Hz for 90 seconds ...
-
bioRxiv - Developmental Biology 2021Quote: ... 30 μl clarified lysate were mixed with 70 μl RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen) according the manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... Biotin-labelled RNA was eluted with 100 μl elution buffer (100 mM DTT in nuclease-free water) and cleaned up with the RNeasy MinElute Cleanup kit (QIAGEN), adjusting the amount of ethanol to capture RNA < 200 nucleotides in length ...
-
bioRxiv - Microbiology 2022Quote: For RNAseq the pellets were resuspended in 150 µL 10 mM Tris-HCl pH 8 and mixed with 700 µL of ice cold RLT+BME (RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2020Quote: ... The eluant was treated with DNase I (1 U/μl) to digest non-specific DNA and the bound DNA was purified from the complex via PCR Qiagen Kit (Qiagen). The purified DNA was amplified with primer sets specific to the prrF1,F2 promoter (Table S2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The samples were purified using 500 μl PB and 650 μl of PE buffer and eluted in 30 μl EB buffer (MinElute PCR Purification Kit, QIAGEN). The adaptor ligation module was implemented using 10 μl of buffer ...
-
bioRxiv - Immunology 2021Quote: THP-1 human monocytes or mature primary human peripheral blood derived macrophages were transfected with control (D-001810-10-05, Dharmacon) or SP140 (L-016508-00-0005, Dharmacon) SMARTpool siRNA (100nM) using HiPerfect reagent (Qiagen) or RNAiMAX (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
bioRxiv - Microbiology 2023Quote: ... fresh 0.35 g/L proteinase K) during two rounds of 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). Total RNA was converted into complementary DNA (cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from FACS-sorted L-GMPs from BL/6 and Il21-/- AML mice using the RNeasy Micro Kit (Qiagen). RNA purity was checked using the NanoPhotometer® spectrophotometer (Implen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Two μL of isolated RNA were used for reverse transcription (RT) and cDNA synthesis using the miRCURY LNA RT Kit (Qiagen) according to the manufacturer’s instructions adding the RNA spike-in UniSp6 as quality control for RT ...
-
bioRxiv - Microbiology 2023Quote: ... in vitro in L-lactate containing minimal media and total RNA was isolated by the TRIzol method and RNeasy minikit (Qiagen). After digestion with TURBO Dnase treatment ...
-
bioRxiv - Microbiology 2024Quote: Viral RNA was extracted from 100 μL of cell supernatant from passages P8 and P16 using a QIAamp Viral RNA kit on the automated QIAcube (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... was resuspended in 200 µL of PBS and DNA was isolated using the gram-positive protocol of the Dneasy Blood and tissue Kit (Qiagen). For each isolation ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet from the first centrifugation was resuspended in 200 µL of PBS and DNA was isolated using the cultured cells protocol of the Dneasy Blood and tissue Kit (Qiagen). The second pellet ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100 μl of chloroform was added and mixed vigorously and the aqueous component was isolated using MaXtract High Density tubes (Qiagen, 129046) using the manufacturers protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA was extracted from 200 μl conditioned medium or 100 μl foetal plasma using the miRNeasy Mini Kit and the miRNeasy Serum/Plasma Kit (Qiagen, Germany). microRNA expression levels were analysed using the nCounter Rat v1.5 miRNA Expression Assay (NanoString Technologies ...
-
bioRxiv - Genetics 2021Quote: ... incubated overnight at 37°C in L-broth containing 50 ng/μL ampicillin and DNA isolated using the QIAprep Spin Miniprep kit (Qiagen 27104) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 3.5 μl of cDNA was used as template and amplified in a total volume of 40 μl with a mix of forward L-VH primers (Table S1) and reverse Cγ primer and using the HotStar® Taq DNA polymerase (Qiagen) and 50 cycles of PCR (94°C 30 s ...
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting 1.5 L bacterial culture was incubated at 37°C for 2h and a Maxiprep performed using Qiagen MaxiPlus kit (Qiagen #12963) to a resulting 1 mg of plasmid DNA ...
-
bioRxiv - Immunology 2023Quote: ... 3.5 μl of cDNA was used as template and amplified in a total volume of 40 μl with a mix of forward L-VH primers (Table S3) and reverse Cγ primer and using the HotStar® Taq DNA polymerase (Qiagen) and 50 cycles of PCR (94°C 30 s ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...