Labshake search
Citations for Qiagen :
51 - 100 of 839 citations for IL 4 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Neuroscience 2021Quote: ... The gene primer for il-1α was a QuantiTect Primer Assay (Cat. No. QT00113505; Qiagen). The sequences for the remaining gene primers can be found in Table 1 and were ordered through Integrated DNA Technologies and diluted to 0.13 μM to be used for PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-22ra1fl/fl/Shh-Cre or WT controls using RNAeasy mini kit (Qiagen, cat: 74106). Isolated RNA was converted into cDNA using a iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from dissected male and female IL or FAC sorted cells using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was isolated from three independent HFK cell populations +/- IL-1β treatment using the RNeasy mini kit (Qiagen). PolyA selection ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: SUZ12 isogenic M3 MPNST cells were treated with or without DNMT inhibitors (50 nM daily Decitabine or 4 μM single dose of GSK862) for 4 days followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Bisulfite sequencing was conducted by the IGO core facility at MSKCC ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...