Labshake search
Citations for Qiagen :
301 - 350 of 1237 citations for IL 2 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... were used for preamplification and qPCR arrays (Rat Antibacterial Response, PARN-148ZE, and Human Antibacterial Response, PAHS-148ZC; Qiagen) were used for the expression analysis of 84 genes involved in innate antibacterial responses in human and rat respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were normalized to the housekeeping human TATA-binding protein (TBP) mRNA (RT2 qPCR Primer Assays, Qiagen) in the GAL4 assay and to the human housekeeping hypoxanthine guanine phosphoribosyltransferase (HPRT ...
-
bioRxiv - Cancer Biology 2019Quote: ... and human BON1 cell line [8] were isolated with RNeasy Plus Universal Kits (Qiagen Cat no. 73404, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 1 μg of a pcDNA3.1 vector containing human αSyn cDNA (provided by T. Baron, Anses, Lyon, France) using Effecten transfection reagent (Qiagen). Positive clones were selected using geneticin and cultured in Dulbecco’s modified Eagle’s medium (DMEM/F-12 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA expression of 84 apoptotic genes was analyzed using the RT2 Profilμer PCR Human Apoptosis Array (Qiagen, PAHS-012Z). Arrays were prepared according to the manufacturer’s protocols applied to the prepared cDNA samples ...
-
bioRxiv - Cancer Biology 2019Quote: ... and was run on miScript miRNA PCR Array Human Ovarian Cancer plates (Qiagen, MIHS-110ZE-4, 384 well plate). PCR plates were read the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... miScript miRNA PCR array of Human Neurological Development and Disease was performed using miScript SYBR green PCR kit (Qiagen). The PCR array contains 84 miRNAs which are differentially expressed during neuronal development and are responsible for progression of neurological diseases.
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Immunology 2021Quote: Between 104 and 3.104 murine and human T cells were sorted from lymph nodes and tumors in TCL buffer (Qiagen) with 1% of β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: The human VCP cDNA was reverse transcribed from total RNA by using Omniscript RT kit (Qiagen Japan, Tokyo, Japan) extracted from A549 cells (RIKEN Cell Bank ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA targets were only included if biochemically confirmed using human tissue or non-species specific methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base[48] ...
-
bioRxiv - Immunology 2021Quote: ... followed by amplification and quantification using RT2 Profiler Human Innate and Adaptive Immune Response 96-well Array (Qiagen, 330231) with RT2 SYBR Green ROX qPCR Mastermix (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: Bacterial DNA was extracted from human and mouse feces-derived bacterial supernatant using the DNeasy powersoil kit (Qiagen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... or postmortem human cerebellar vermis samples using either the RNeasy Kit or RNeasy Fibrous Tissue Kit following the manufacturer’s protocols (QIAGEN). For tissue RNA extraction ...
-
bioRxiv - Cancer Biology 2022Quote: ... The sequenced reads were mapped with the hg38 human genome and sequence analysis was done by the CLC genomics workbench (12.0.3, Qiagen Bioinformatics). Additionally ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from both NHP and human stool samples using the PowerFecal DNA Isolation Kit (Qiagen, Valencia, CA). Sequencing of the 16s small subunit ribosomal ribonucleic acid (SSU rRNA ...
-
bioRxiv - Microbiology 2023Quote: ... Human DNA from whole cell extracts of A549 cells was purified using the DNeasy Blood and Tissue kit (Qiagen). RNAseA (Thermo ...
-
bioRxiv - Microbiology 2023Quote: Total genomic DNA was extracted from human tissue and cyst fluid using the QIAamp Mini kit (Qiagen, Hilden, Germany). Extractions were performed per manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Raw FASTQ reads were aligned to the GRCh38 human genome using CLC Genomics Workbench version 22.0.2 software (Qiagen, USA). Differential gene expression was determined using the built-in tool in CLC Genomics workbench ...
-
bioRxiv - Physiology 2024Quote: RNA was extracted from human tissue derived organoids and neutrophils using the RNeasy® Plus Mini Kit (Qiagen, #74104) with cDNA prepared using a SuperScript™ VILO™ cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA (200 ng) was used for quantitative PCR with the Human Cellular Senescence RT2 Profiler™ PCR Array (Qiagen) containing 84 key genes involved in the initiation and progression of the biological process causing cells to lose the ability to divide ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted from the cell pellets of human primary male and female PT cells using the RNAeasy Mini Kit (Qiagen). After quantifying RNA concentration in a Nanodrop instrument (Thermo) ...
-
bioRxiv - Cancer Biology 2019Quote: ... was isolated from human PanNET specimens or cells grown on 6-cm or 10-cm plates using RNeasy mini kit (Qiagen) containing gDNA eliminator spin columns ...
-
bioRxiv - Molecular Biology 2019Quote: Preliminary screening for the presence of serum exosomal miRNAs was determined using a miScript human miFinder PCR array (MIHS-001Z, Qiagen). RNA was converted to cDNA using miScript RT kit (218060) ...
-
bioRxiv - Plant Biology 2019Quote: ... three replicates of 25 to 30 pooled egg cells were used for total RNA extraction according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (Qiagen). In brief ...
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... Synthetized cDNA was subjected to a PCR array specific for the human antiviral response (RT² Profiler PCR array – PAHS-122Z, SA Biosciences, Qiagen), according to the manufacturer’s instructions ...