Labshake search
Citations for Qiagen :
1 - 50 of 517 citations for IL 15RA&IL 15 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... IL-23p19 primers were purchased from QIAGEN and the sequence for osteopontin primers are ...
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Cancer Biology 2020Quote: Total mRNA was extracted from dissected IL using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... IL]) and homogenized using a stainless steel bead in TissueLyser II (Qiagen, Germany) for 2 min at 30 Hz ...
-
bioRxiv - Neuroscience 2023Quote: ... The tube indices from the QIAseq miRNA NGS 48 Index IL (Qiagen, 331595) were used for library preparation.
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Neuroscience 2021Quote: ... The gene primer for il-1α was a QuantiTect Primer Assay (Cat. No. QT00113505; Qiagen). The sequences for the remaining gene primers can be found in Table 1 and were ordered through Integrated DNA Technologies and diluted to 0.13 μM to be used for PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-22ra1fl/fl/Shh-Cre or WT controls using RNAeasy mini kit (Qiagen, cat: 74106). Isolated RNA was converted into cDNA using a iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from dissected male and female IL or FAC sorted cells using the RNeasy Micro kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was isolated from three independent HFK cell populations +/- IL-1β treatment using the RNeasy mini kit (Qiagen). PolyA selection ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using a forward primer that has a unique index and the reverse primer has another unique index for dual indexing (QIAseq miRNA 96 Index Kit IL UDI, #331645, Qiagen). Successful library production ...
-
bioRxiv - Immunology 2023Quote: ... colonic Foxp3(GFP)+IL-10(Thy1.1)+ and Foxp3(GFP)+IL-10(Thy1.1)- cells were sorted into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: ... Clones were verified by sequencing (ACGT; Wheeling, IL) and grown for midi-scale production and purification using a Qiagen Plasmid Plus Midiprep kit (Qiagen 12943).
-
bioRxiv - Bioengineering 2022Quote: RNA was isolated from hBSMC microtissues that were either untreated or treated with TGF-β1 and IL-13 for 7 days prior to RNA isolation using the RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Cancer Biology 2022Quote: MIEV-or PKCα-KR-transduced HSPCs were co-cultured on OP9 cells in the presence of IL-7 for 17-23 days (late co-culture) and total RNA was isolated using an RNeasy kit (Qiagen, Manchester, UK) from five independent co-cultures ...
-
bioRxiv - Microbiology 2023Quote: ... a 1 mL aliquot was sterile filtered and kept to test conditioned media for IL-10 induction (as above)) and replaced with 5 mL of RNA-protect (Qiagen, Cat. # 1018390), mixed by pipetting ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells and MEFs were transiently transfected with PolyFect (Qiagen) and Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection of HEK293 cells was performed using Attractene transfection reagent (Qiagen) by the fast-forward transfection approach following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... or EGFP-Lin52 fusions into HEK293-GP cells with Effectene (Qiagen) for transduction as described previously (58).
-
bioRxiv - Cell Biology 2021Quote: ... HEK293 or U20S cells with the RNeasy Mini-kit (Qiagen, Hilden, Germany) and quantified with a NanoDrop 8000 spectrophotometer (Thermo-Fisher) ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2024Quote: The HEK293 stable cell lines were generate by a transfection with Effectene (Qiagen) and 1µg plasmid (pmCherry-N1-hERG-WT and -A561V ...
-
bioRxiv - Immunology 2020Quote: Total RNA of IFN-α2 treated HEK293 cells was purified using RNeasy columns (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were transfected with hTRPM3α2-GFP or its mutants using the Effectene reagent (Qiagen). Cells were loaded with 1 μM fura-2 AM (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2019Quote: ... by retrotranscription of RNAs from HeLa and HEK293-T cells using the QuantiTect Reverse Transcription kit (Qiagen) followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was extracted from the parental and knockout HEK293 cells using QIAamp DNA mini kit (QIAGEN) and PCR amplified with primers located ~500-600 bp from the sgRNA target site ...
-
bioRxiv - Genetics 2023Quote: The extraction of total RNA from HEK293 stable cell lines was isolated by RNeasy mini kit (QIAGEN), and cDNA was reversed with Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen) for purification ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen). Proteins were washed two times with 750 μl of buffer A (or AG ...
-
bioRxiv - Immunology 2023Quote: ... and 15 µl of HiPerFect (Qiagen) transfection reagent was added ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1.0–3.0 μl (5.0–15 pmol) of primers and 7.5–15 μl of 2x Multiplex PCR Plus Master mix (QIAGEN). The PCR protocol consisted of an initial DNA polymerase (HotStar Taq ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 15 min of DNase I (Qiagen) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...