Labshake search
Citations for Qiagen :
1 - 50 of 1517 citations for Hydrotris pyrazol 1 ylborato trichlorotitanium IV since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and the JCSG screens I-IV (Qiagen). Promising conditions were further screened and scaled up 10-fold to 4 μL hanging drops with a 500 μL reservoir volume ...
-
bioRxiv - Microbiology 2020Quote: ... vapor-diffusion crystallization trials were conducted using the JCSG Core I-IV screens (Qiagen), setup using a Mosquito Crystal (TTP ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 384 different conditions were included in the screen (JCSG Core Suite I-IV, Qiagen) and crystals obtained in 0.2 M disodium tartrate supplemented with 20% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... Screening plates were set up by a sitting-drop vapor diffusion method using JCSG Core I-IV (Qiagen), PEG Suite I-II (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: The nsp10:16 protein complex was supplemented by 1 mM sinefungin Crystals of the nsp10:nsp16 protein complex grew in three days in commercial JCSG I-IV screens (Qiagen). They were cryo-protected in mother liquor supplemented with 20% glycerol and flash frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The histidine-tagged PFam54-IV were produced and purified by nickel affinity chromatography with Ni-NTA agarose according to the manufacturer’s instructions (Qiagen, Valencia, CA).
-
bioRxiv - Molecular Biology 2024Quote: ... The drop was a mixture of 1.0 µl of a 10 mg/ml protein solution with the equivalent volume of reservoir buffer from the commercial crystallization kits (JCSG core I-IV, classics, classics II, PEGs, PEGsII, and MPD suite from Qiagen, Venlo, the Netherlands). The initial needle-and plate-shaped crystals appeared under eight and one conditions ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl 1 mg/ml Carrier RNA (QIAGEN), 1 µl 10% SDS ...
-
bioRxiv - Genomics 2020Quote: ... 1 mM EDTA and 1% freshly added Proteinase K (Qiagen)) was added to the cell suspension ...
-
bioRxiv - Cell Biology 2021Quote: ... DNase 1 (Qiagen) was used to remove contaminating DNA followed by a second cleanup ...
-
bioRxiv - Developmental Biology 2022Quote: ... SPACA6 concentrated to 7 mg mL−1 in Buffer B was mixed in a 1:1 volumetric ratio (0.3:0.3 mL) with JCSG+ (Qiagen), Cryos (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Immunology 2022Quote: ... Virus was inactivated by mixing 1:1 with Buffer ATL (Qiagen) prior to viral RNA extraction from NP swabs ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 μg DNA ratio using Effectene transfection reagent (Qiagen). Recombinant luciferase-expressing viruses capable of a single round of replication were released into the cell medium and were harvested 48 h later ...
-
bioRxiv - Microbiology 2023Quote: ... the pCMVΔP1Δenv HIV-1 Gag-Pol packaging construct and the firefly luciferase-expressing HIV-1 vector at a 1:1:3 µg DNA ratio using effectene transfection reagent (Qiagen). Recombinant ...
-
bioRxiv - Microbiology 2023Quote: ... 5.0 x105 293T cells were co-transfected with HIV-1 Env-expressing and HIV-1 Tat-expressing plasmids at a ratio of 1:6 using Effectene (Qiagen) and incubated for 48 hours ...
-
bioRxiv - Genomics 2020Quote: ... 1 ul (1U/ul) UDG and 1 ul RNaseA (100 mg/ml, Qiagen) and reactions were incubated at 37°C for 3 hrs ...
-
bioRxiv - Genomics 2023Quote: ... gracilis (1 male and 1 female) using the Rneasy Mini Plant Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... slides were treated with 1 mg/ml RNase A (1 mg/ml, Qiagen, 19101) in 2x SSC for at least 45 min at 37°C and then dehydrated in a 70% ...
-
bioRxiv - Biophysics 2022Quote: ... supernatant was combined with Ni-NTA resin (1 mL/1 L of biomass, Qiagen) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× QuantiNova RT Mix (Qiagen), 1× QuantiNova SYBR Green RT-PCR Master mix ...
-
bioRxiv - Microbiology 2021Quote: ... Strep 1:1000 (Qiagen, 34850).
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μM oligo-dT18 (Qiagen) and 10 μM random hexamers (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μl of DNase (Qiagen) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 U Hotstar Taq (Qiagen), 1X Hotstar Taq buffer ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μM TSO (Qiagen). The master mix was dispensed using the MANTIS liquid dispenser followed by mixing for 1 min at 1800 rpm on a plate shaker (Biosan) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of QIAzol (Qiagen) was added to each pellet suspension before being transferred to Lysing Matrix B tubes (MP Biomedicals) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Immunology 2024Quote: ... 1 mL RLT Buffer (Qiagen) was added to the thawed lungs ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...