Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Human Protein Patched Homolog 2 PTCH2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... IL-8 ELISA was performed according to manufacturer instructions (Qiagen).
-
bioRxiv - Bioengineering 2021Quote: Cells were lysed for total protein in 96-well format using the Qproteome Mammalian Protein Prep Kit (Cat. 37901, Qiagen). Protein lysates were loaded onto and analyzed using the WesTM (ProteinSimple ...
-
bioRxiv - Cell Biology 2020Quote: DNA and proteins were extracted from approximately 30 of quadriceps muscles using AllPrep DNA/RNA/Protein Mini kit (#80004, Qiagen). DNA concentrations were determined by Thermo Scientific NanoDrop 2000c spectrophotometer ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and proteins were extracted from these individuals using the AllPrep DNA/RNA/Protein Mini Kit (Cat. No. 80004, Qiagen). RNA libraries were constructed for these individuals at Novogene ...
-
bioRxiv - Bioengineering 2023Quote: ... and protein were collected from tissues using the AllPrep DNA/RNA/protein Mini Kit (QIAGEN, Venlo, the Netherlands, CAT# 80004) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA and proteins were extracted from the four individuals using the AllPrep DNA/RNA/Protein Mini Kit (Cat. No. 80004, Qiagen). DNA libraries were constructed for these six individuals at HyLabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein purification was performed using Ni+2-NTA agarose affinity chromatography according to standard protocol (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... Protein extract was subjected to IMAC by incubation with 2 ml Ni-NTA resin (Qiagen, Germany) per 50 ml of extract ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Total protein was extracted using the Qiagen All prep mini kit (Qiagen) after elution through the RNA spin column ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... DNA extracts were prepared using Allprep Bacterial DNA/RNA/Protein Kit (Qiagen) following the manufacturer’s instructions and further submitted to Genewiz for bacterial 16S-EZ sequencing (V3 and V4 hypervariable regions ...
-
bioRxiv - Cancer Biology 2023Quote: Total DNA was extracted with AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Microbiome DNAs were extracted from the human samples on the same day of collection using the microbiome-specific kit (QIAamp DNA Microbiome Kit; Qiagen, Hilden, Germany). The DNA extraction was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA from human cancer cells was extracted 48h post transfection using the RNeasy Kit from Qiagen according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from murine and human monocytes with the RNeasy Plus Micro Kit (Qiagen), and then 200 ng of RNA was reverse transcribed using the iScript RT Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Microbiology 2021Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... and grown to confluency and transfected with human Leptin constructs using Effectene kit (Cat# 301427, QIAGEN).
-
bioRxiv - Cancer Biology 2023Quote: gDNA was isolated from human sarcoma models and controls using the QIAamp DNA Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from human primary immune cells using the RNeasy Plus Micro Kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... RNA and protein were extracted 6 days post-transduction using the AllPrep RNA/Protein kit (Cat: 80204, Qiagen, Germantown, MD USA). RNA was converted to cDNA using SuperScript IV cDNA Synthesis Kit (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Genomics 2019Quote: ... RNA attached to purified protein complexes was isolated with the miRNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted using AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Whole DNA and proteins were extracted by the ALLprep Kit (Qiagen, Hilden, Germany), following manufacturer instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... EV and protein fractions using miRNeasy serum/plasma kit (Qiagen 1071073 Lot#160020206) after adding 1.0×10^6 copies/µL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035) ...
-
bioRxiv - Microbiology 2019Quote: The Microbial DNA qPCR Array Intestinal Infection 2 kit (Qiagen, Hilden, Germany) (Supplementary table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Microbiology 2022Quote: ... (2) PCR purification was conducted using the QIAquick PCR Purification Kit (Qiagen), and (3 ...
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... from pellets of 2 × 106 cells using the RNeasy mini kit (Qiagen) or RIPA buffer ...
-
bioRxiv - Genetics 2020Quote: ... rad54-1 and rad54-2 plants using RNeasy Plant mini Kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and a 2% agarose gel using the QIAquick gel extraction kit (Qiagen). In a second PCR ...
-
bioRxiv - Genomics 2021Quote: SARS-CoV-2 RNA was extracted with QIAamp Viral Mini Kit (Qiagen) in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... for DNA extraction and (2) RNeasy Mini Kit (Qiagen, cat. no. 74104) for RNA.
-
bioRxiv - Immunology 2024Quote: ... 2 × QuantiFast SYBR Green PCR Master Mix kit (QiaGen, Cat No. 204056) was used following the manufacturer’s instructions ...