Labshake search
Citations for Qiagen :
651 - 700 of 10000+ citations for Human Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was isolated using the Nucleospin RNA II kit (Macherey & Nagel) according to the manufacturer’s instructions and reverse transcribed into cDNA by using the QantiTect reverse transcription kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... the total RNA (containing small RNAs) was subjected to miRNA reverse transcription using the miScript II RT Kit (Qiagen), following the manual ...
-
bioRxiv - Neuroscience 2020Quote: ... From control and lesion specimens 500ng of total RNA were reverse transcribed using the Quantitect reverse transcription kit (Qiagen). Quality and purity of cDNAs was confirmed by Agarose gel Electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of RNA from each sample was used for cDNA synthesis by using QuantiTect Reverse Transcription Kit (QIAGEN). Quantitative PCR was performed using SYBR Green PCR Master Mix in QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA) using QuantiTect Reverse transcription kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... a QuantiTect® Reverse Transcription Kit was used for genomic DNA wipeout and cDNA synthesis (Cat. No. 205314, Qiagen). Relative gene expression was measured using a RealMasterMix™ Fast SYBR Kit (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... All DNA templates for in vitro transcription were purified on agarose gels using the QIAquick Gel Extraction Kit (QIAGEN). Sequences of oligos used for generating DNA templates are provided in supplementary file 1.
-
bioRxiv - Molecular Biology 2020Quote: ... All DNA templates used for in vitro transcription were PCR amplified and purified with a gel extraction kit (QIAGEN). The T7 promoter (TAATACGACTCACTATAGGG ...
-
bioRxiv - Bioengineering 2023Quote: Extracted total RNA was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit protocol (#205311, Qiagen, Germantown, MD). Pre-designed primers were purchased for FLRT2 (#Hs00544171_s1 ...
-
bioRxiv - Immunology 2023Quote: ... 1 μg of RNA was pre-treated with gDNA Wipeout Buffer and reverse-transcribed to cDNA according to the manufacturer’s instructions using QuantiTect Reverse Transcription Kit (QIAGEN). Quantitative gene expression analysis was performed using the LightCycler®480 SYBR Green I Master (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... Removal of genomic DNA and cDNA synthesis was carried out using the QuantiNova Reverse Transcription Kit (Qiagen, Hilden, Germany) with 200 ng of total RNA as a template ...
-
bioRxiv - Microbiology 2024Quote: ... A total of 500 ng of RNA was used to synthesize cDNA using the QuantiTech reverse transcription kit (Qiagen). The cDNA samples were then diluted 1:10 and used as a template to perform RT-qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription and quantitative real-time PCR were performed with the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany). Since the endogenous retrovirus envelope comprises only one exon ...
-
bioRxiv - Cell Biology 2022Quote: ... and reverse transcription to cDNA (Omniscript, Qiagen) was conducted using 500 ng RNA per sample ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: RNA isolation and reverse transcription for murine samples from the GRN-FTD proof of concept study was completed using the QIAsymphony RNA kit (Qiagen). Absolute quantification of transgene copies per microgram of tissue was completed using a standard curve of in vitro transcribed WPRE RNA and specific primers and probes targeting WPRE (WPRE v2 ...
-
bioRxiv - Physiology 2020Quote: ... ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen) on an iCycler instrument (BioRad) ...
-
bioRxiv - Neuroscience 2019Quote: 1μg of RNA was used for cDNA synthesis prepared from the Quantitect Reverse Transcription Kit according to the manufactures’ protocol (Qiagen). Quantitative PCR was then performed on a RotorGeneQ (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was quantified using the Nano-Drop 8000 (Thermo Fischer) followed by cDNA synthesis using QuantiTect Reverse Transcription kit (Qiagen). The primers for PCR with reverse transcription reactions are listed in Supplemental Table 2 ...
-
bioRxiv - Molecular Biology 2019Quote: Reverse transcription (RT) of total RNA to cDNA was performed in 50 μL reaction volumes using the miRCURY RT kit (Qiagen) and 10 μL total RNA as input ...
-
bioRxiv - Microbiology 2019Quote: ... 500 ng of RNA were reverse transcribed in a final volume of 20 µl using QuantiTect Reverse Transcription Kit (Qiagen). Real-time PCR was performed using SYBR Green PowerUp (ThermoScientific ...
-
bioRxiv - Microbiology 2021Quote: Five nanograms of mRNA were analyzed by quantitative reverse transcription-PCR (qRT-PCR) using the QuantiFast SYBR green RT-PCR kit (Qiagen). qRT-PCR-based quantification of IL-6 ...
-
bioRxiv - Bioengineering 2021Quote: ... 600 ng of total RNA was used for complementary DNA (cDNA) synthesis using a QuantiTect Reverse Transcription Kit from Qiagen following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from isolated brains as described before42 and using the QuantiTect Reverse Transcription Kit (QIAGEN Cat. No. 205311) 200ng of RNA was transcribed into cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... specific to the DNA sequence (or cDNA sequence from reverse transcribed clone G2 RNA samples (QuantiTect Reverse Transcription Kit, Qiagen)) for PCR (PCR SuperMix High Fidelity ...
-
bioRxiv - Biochemistry 2021Quote: ... Approximately 0.8 µg of RNA was used for cDNA synthesis according to manufacturer’s instructions of the QuantiTect® Reverse Transcription Kit (Qiagen). 1 µl of cDNA was used for semi-quantitative reverse-transcriptase polymerase chain reaction ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was retro-transcribed into complementary DNA (cDNA) by using the QuantiTect Reverse Transcription Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Pathology 2022Quote: ... ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen) on an iCycler instrument (BioRad) ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA sample was treated with DNase I to remove genomic DNA and retro transcribed into cDNA using Quantitect Reverse Transcription Kit (Qiagen).
-
bioRxiv - Molecular Biology 2020Quote: ... RNA concentration and purity were measured by a spectrophotometer and 2 μg were used to synthesize cDNA by QuantiTect Reverse Transcription kit (Qiagen). Real-time amplification was performed in a Mastercycler EP Realplex (Eppendorf ...
-
bioRxiv - Microbiology 2019Quote: RNA was harvested from late-log phase Mtb and the 3’ end of Mcr11 was mapped using the miScript Reverse Transcription Kit (Qiagen) (88 ...
-
bioRxiv - Microbiology 2020Quote: ... for various immune genes were used to amplify cDNA collected from lungs using QuantiNova reverse transcription and SYBR Green I PCR kits (Qiagen). The ΔΔCq method was used with normalization within sample on GAPDH (ΔCq ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was performed on three biological replicates of each in planta time point and two biological replicates for the mycelia timepoints with the QuantiTech Reverse Transcription Kit (Qiagen). In planta timepoints ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.5 µg RNA was converted into cDNA using the Quantitect® Reverse Transcription Kit (Cat. No. 205311, Qiagen, Limburg, Netherlands). To ensure the removal of genomic DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA concentration and purity were measured by a spectrophotometer and 2 ug were used to synthesize cDNA by QuantiTect Reverse Transcription kit (Qiagen). Real-time amplification was performed in a Mastercycler EP Realplex (Eppendorf ...
-
bioRxiv - Microbiology 2021Quote: ... ML336 resistant mutation emerging in nsP2 at passage 10 was confirmed by purification and reverse transcription of viral RNA from cell supernatants using RNeasy Mini Kit (Qiagen) and SuperScript IV First-Strand Synthesis kit (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized from total input RNA and oligo(dT)-isolated RNA with the QuantiTect Reverse Transcription Kit (205311, Qiagen). All qRT-PCRs were performed with the SYBR green method ...