Labshake search
Citations for Qiagen :
251 - 300 of 10000+ citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pax6 and non-specific control siRNA were used (predesigned FlexiTube siRNAs, Qiagen). For siRNA transfection ...
-
bioRxiv - Immunology 2024Quote: ... STAT2 and 18s rRNA were measured using validated gene-specific primers (QIAGEN). Primers for ACAT1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A mouse Yy1-specific siRNA or the AllStars Negative Control siRNA (Qiagen) was co-transfected with an L1 promoter reporter plasmid using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA was extracted from EVs (20 μg protein) using miRNeasy Mini Kit (Qiagen). RNA was then reverse-transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: Total cellular RNA was extracted using AllPrep DNA/RNA/Protein mini kit (Qiagen, UK). Reverse transcription was carried out using kits from Invitrogen following the manufacturer’s instructions (SuperScript First-Strand Synthesis System for RT-PCR) ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was then isolated with Qiagen AllPrep DNA/RNA/Protein Mini Kit (Qiagen # 80004). Breast microstructures from 5 independent donors were exposed to vehicle (PBS and PBS plus DMSO) ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria isolates then underwent DNA isolation using AllPrep Bacterial DNA/RNA/Protein Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from INS-1 and human islets 48 hours post transfection using RNeasy cleanup kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: Microbial genomic DNA was extracted from the human stool samples using the DNeasy PowerSoil DNA Isolation Kit (Qiagen). The V4 region of 16S rRNA gene was amplified and sequenced using the Illumina MiSeq platform(67) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human HDL (40nM) or PBS for 48 hours prior to RNA isolation using the RNeasy Mini kit (Qiagen). RNA samples were converted to cDNA libraries by the Northwestern University Genomics Core facility and were then run on the Illumina HT-12 microarray ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 22 human vaginal samples using the QIAamp UCP Pathogen Mini Kit (QIAGEN, Venlo, Netherlands) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA from murine or human monocytes was isolated using AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, 80224). DNA (1 µg ...
-
bioRxiv - Neuroscience 2021Quote: The total RNA from mouse cortex and human PBMC was extracted using the RNeasy® Mini Kit (Qiagen) and real-time PCR was done as described in the Supplementary material.
-
bioRxiv - Neuroscience 2020Quote: ... RNA was isolated from human autopsy brain tissue using the RNeasy Plus Universal Mini Kit (Qiagen Cat# 73404).
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Bulk gDNA and RNA from human retinal organoids were isolated using the AllPrep DNA/RNA Micro Kit (Qiagen) or DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from human glioblastoma cells using the RNeasy kit according to the manufacturer’s instructions (Qiagen). RNA quality was assessed on a Bioanalyzer (Agilent ...
-
bioRxiv - Pathology 2023Quote: Total RNA was extracted from the frozen human stomach tissues using the RNeasy plus Mini Kit (Qiagen, US) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was collected from treated human or murine primary spinal cord astrocytes using an RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human myeloma cell lines were authenticated by subjecting genomic DNA isolated with the QIAamp DNA Mini Kit (Qiagen), and short tandem repeat (STR ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from the human biopsy samples and mice colon tissue was isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Lysates were incubated for 1 hr at 37°C after adding 10 µl of RNAse A (20 mg/ml) and proteins were precipitated with 200 µl of Protein Precipitation Solution (Qiagen Gentra Puregen Cell kit). After centrifugation ...
-
bioRxiv - Molecular Biology 2019Quote: ... mixed D1R and D5R-specific siRNA (#SI00015792, #SI00015869, Qiagen Science Inc., Germantown, MD) or non-silencing “mock” siRNA ...
-
bioRxiv - Plant Biology 2020Quote: ... using gene-specific primers (Table S1) by employing a Rotor-Gene Q6000 (Qiagen). qPCR conditions were composed of three steps of cycling ...
-
bioRxiv - Microbiology 2021Quote: ... The AllStars negative control siRNA was used as a non-specific control (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: A Wnt-specific TCF/LEF-driven reporter plasmid was used (Qiagen, Valencia, CA). The C2C12 cells were trypsinized and seeded in triplicate wells at 50,000 cells/well in 12-well plates on day 1 ...
-
bioRxiv - Biophysics 2020Quote: ... Real-Time PCR was performed with specific primers purchased from Qiagen (Tables 1,2) and Power SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... specific siRNAs (SI02225825 for PPP2R2A and SI02759148 for PPP2R2D)) were purchased from Qiagen. ON-TARGET plus SMARTpool siRNAS against human ENSA (L-011852-00 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and qPCR was performed using gene specific QuantiTect Primer Assay primers from Qiagen. Relative expression levels were normalized to gapdh expression according to the formula <2^− (Ct gene of interest − Ct gapdh ...
-
bioRxiv - Cell Biology 2021Quote: ... The AllStars Negative Control siRNA and gene-specific siRNAs were purchased from Qiagen and Eurofinns ...
-
bioRxiv - Cancer Biology 2020Quote: ... and internal control EIF3D and RPL13A specific primers (RT2 qPCR Primer Assays -Qiagen) and RT² SYBR® Green qPCR master mix using the recommended protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the respective Quantitect Primer pairs for detection of specific mRNAs (Qiagen, Hilden, Germany), and StepOnePlusTM qPCR system (2-ΔΔCT method) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Specific primer pairs (miScript Primer Assay or miRCURY LNA miRNA PCR Assay, Qiagen) for miR-142-5p and RNU48 were used ...
-
bioRxiv - Plant Biology 2023Quote: ... using specific primers (Supplemental Table 1) in a Rotor-Gene Q machine (Qiagen). Standard curves were achieved by dilutions of one cDNA sample ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected with either 100 nM of the specific YTHDF1 siRNA (SI00764715, Qiagen) or 100 nM siGENOME non-targeting siRNA (Dharmacon ...
-
bioRxiv - Cell Biology 2023Quote: ... specific siRNAs (SI02225825 for PPP2R2A and SI02759148 for PPP2R2D) were purchased from Qiagen and transfected using Hiperfect (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products from reactions producing a specific fragment underwent PCR clean-up (Qiagen) and ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific siRNA oligonucleotides for β-catenin and control siRNA were obtained from Qiagen, Caveolin-1 ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...