Labshake search
Citations for Qiagen :
251 - 300 of 10000+ citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for both genomic and subgenomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... The eluant was treated with DNase I (1 U/μl) to digest non-specific DNA and the bound DNA was purified from the complex via PCR Qiagen Kit (Qiagen). The purified DNA was amplified with primer sets specific to the prrF1,F2 promoter (Table S2 ...
-
bioRxiv - Microbiology 2019Quote: ... The HA and NA influenza segments (complete or fragments) were amplified from cDNA template using subtype-specific set of primers and purified with QIAquick PCR Purification kit (Qiagen). Nucleotide sequences of viral genes were determined using BrilliantDye™v3.1 Terminal Cycle Sequencing Kit (Nimagen) ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we designed strain-specific primers (see Supplementary Table 2) and generated overlapping amplicons using the OneStep RT-PCR Kit (Qiagen) and 5 µL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 uM gene specific primers pairs (hVDAC1, hVDAC2, hVDAC3, ß-actin) and 12.5 ul of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Three independent experiments of quantitative real-time were performed in triplicate for each sample ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain specific amplicon was isolated using electrophoresis with low-melting point agarose extraction with the QIAquick Gel Extraction kit (Qiagen). A secondary amplification was performed using a modification of the primers (VHH-Esp-For ...
-
bioRxiv - Microbiology 2024Quote: ... transposon junctions were amplified by using a transposon-specific primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC) and a primer P7 (CAAGCAGAAGACGGCATACGAGAT) using the HotStarTaq master mix kit (Qiagen). The himar1-enriched samples were diluted in a ratio of 1:50 ...
-
bioRxiv - Evolutionary Biology 2019Quote: Total DNA was extracted from tadpole tails by overnight digestion in 10% proteinase K solution at 56 °C and extracted using the Qiagen Biosprint 96 DNA blood kit (Qiagen, CA, USA). DNA was eluted in 100 - 200 μL buffer AE (QIAgen).
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA was extracted from the tongue tissue after treating the tissue with proteinase K using a Qiagen Genomic Tip Kit for High Molecular Weight DNA following Qiagen’s extraction protocol (Qiagen, Valencia, CA, USA). After extraction ...
-
bioRxiv - Microbiology 2020Quote: ... of a 6-well plate in 200 μL ice-cold PBS + 10% Proteinase K and processed through the DNeasy Blood and Tissue Kit following manufacture protocols (QIAGEN, Hilden, Germany). gDNA was stored at −20° C for short-term storage or −80° C for long-term storage.
-
bioRxiv - Microbiology 2022Quote: ... of a 6-well plate in 200 μL ice-cold PBS + 10% Proteinase K and processed through the DNeasy Blood and Tissue Kit following manufacture protocols (QIAGEN, Hilden, Germany). gDNA was stored at -20° C for short-term storage or -80° C for long-term storage.
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was treated with proteinase K at 42°C for 2 hrs and purified using MinElute PCR Purification Kit (Qiagen, Cat# 28004).
-
bioRxiv - Microbiology 2023Quote: ... Bacterial cells were lysed by enzymatic lysis and proteinase K treatment and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) with subsequent DNAse treatment using the RapidOut DNA removal kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... After 24 hours the media was removed for ELISA and the cells were lysed and RNA extracted (RNeasy Mini Kit, Qiagen).
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Neuroscience 2021Quote: ... or postmortem human cerebellar vermis samples using either the RNeasy Kit or RNeasy Fibrous Tissue Kit following the manufacturer’s protocols (QIAGEN). For tissue RNA extraction ...
-
bioRxiv - Bioengineering 2022Quote: ... Lysine-Cocrystallization was optimized with JCSG + suite screen (Qiagen, Hilden, Germany) condition 42 (20% PEG8000 ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA from MCF7 cells was isolated by proteinase K digestion at 65°C for 30 minutes followed by purification using the QIAamp circulating nucleic acid kit (Qiagen, Venlo, The Netherlands). Genomic DNA from frozen tissue sections of colorectal liver metastases was isolated using the NucleoSpin Tissue kit according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2020Quote: ... was digested overnight at 56°C in 20 ul proteinase K and 180 ul Buffer ATL from the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Valencia, California, USA). DNA was extracted from the digest with the QIAamp PowerFecal DNA Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Buffer G2 and proteinase K were incubated at 56°C overnight and extracted using the EZ1 DNeasy Blood Tissue Kit (Qiagen GmbH, Hilden, Germany) in line with the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Each gene segment was amplified using segment-specific primers and extracted from 1% gel slices using Qiagen Gel Extraction Kit (Qiagen, Germany). Purified gene segments were cloned into the plasmid pHWSccdB as previously done (27) ...
-
bioRxiv - Molecular Biology 2021Quote: The gene of interest was amplified using PCR with gene-specific primers and purified using the QIAquick PCR Purification Kit (QIAGEN, Germany). Gene-specific T7 promoter sequences were added to the 5’ and 3’ end of the purified product using PCR and were purified ...
-
bioRxiv - Genomics 2022Quote: ... was extracted from drug-specific resistant cell lines together with their isogenic parental lines using the DNeasy® Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of bisulfite converted DNA was used as template to amplify target genomic regions using specific primers (one biotinylated) with the PyroMark PCR kit (Qiagen, #978703), following the recommended conditions (annealing temperature 56°C) ...
-
bioRxiv - Molecular Biology 2021Quote: ... while URA3 and ACT1 levels were measured by one-step RT-PCR with specific primers (Supplementary Table S3) following the standard protocol of the RNeasy® Mini kit (Qiagen). All strains were propagated for at least 100 generations before analysis.
-
bioRxiv - Immunology 2020Quote: ... Up to 8 colonies were selected for each TCRα and TCRβ sequence for each of the KRASG12V/D-specific T cell clones and DNA was isolated using a QIAprep Spin Miniprep Kit (QIAGEN, 27104) and sequenced using the M13F and M13R primers ...
-
bioRxiv - Plant Biology 2022Quote: ... Technical duplicates of gene-specific products were synthesised in 10 µl reactions using the Rotor-Gene SYBR Green PCR kit (Qiagen, UK) on a Rotor-Gene 6000 Real-Time PCR machine (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA thus obtained was diluted to 2 ng/µl and specific target miRNAs were amplified by qPCR using the miRCURY LNA SYBR Green PCR kit (Qiagen, 339346). Expression of all targets was normalised against the expression of two reference genes (SNORD48 and U6 ...
-
bioRxiv - Genetics 2021Quote: Human genomic DNA (gDNA) was extracted using the QIAamp DNA Mini Kit (QIAGEN, Germany) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Immunology 2021Quote: ... total RNA of CD8+ human T cells was extracted by miRNeasy Mini Kit (Qiagen), following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and human islets were isolated using RNeasy Mini or Micro kits (Qiagen; Valencia, CA). Reverse transcription was completed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... rodent tissues and human samples using the Qiagen Blood and Tissue Kit (Qiagen, USA). The procedures prior to protein digestion were as follows ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA from cultured human cells were isolated using the QIAamp DNA kit (Qiagen) and genomic DNA from MEFs and mouse tissue samples were extracted using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from human cells with an RNA purification kit (Qiagen, 74134) and genomic DNA was removed by genomic DNA binding columns in the kit ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA was extracted from cultured human ECs using a RNeasy Mini kit (Qiagen). For reverse transcription ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or human ABCB1-transfected MDR-19 cells using the RNeasy Mini extraction kit (Qiagen). First strand cDNA synthesis was performed on 500 ng of template RNA using MMLV reverse transcriptase (fc 10 units/µl) ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from human islets using the miRNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from human cells using RNeasy Mini kits (QIAGEN, Hilden, Germany) and reverse transcribed using Super-Script III (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... A total of 78 serum samples (positive for HEV IgM in ELISA) were subjected to RNA extraction using QIAamp Viral RNA Mini Kit (Qiagen, Germany). Using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... 150 mM NaCl) with 400 ng/μl Proteinase K (Qiagen #19131) and reverse-crosslinked overnight at 65°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteinase digestion was performed with 1 mg/mL proteinase K (Qiagen) in the presence or absence of 1% Triton X-100 for 30 min at 37 °C as reported previously64 ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Microbiology 2019Quote: ... Proteinase K solution (50 μL at 20 mg/mL, QIAGEN/5PRIME) and SDS solution (100 μL at 20% ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rehydrated embryos were treated with 10 μg/ml proteinase K (Qiagen) in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... we established our own alternative protocol including proteinase K (19133, Qiagen) for tissue digestion ...
-
bioRxiv - Neuroscience 2022Quote: ... and 6μL/sample of 20mg/mL proteinase K (Qiagen, mat #1114886). Lysis completed with a 30-minute incubation at 55°C ...