Labshake search
Citations for Qiagen :
201 - 250 of 1477 citations for Human IgM Anti SARS CoV 2 Spike S1 Antibody CR3022 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed overnight using a mouse monoclonal anti-StrepII antibody (Qiagen catalog number 34850) at a 1:2500-1:5000 dilution or a rabbit polyclonal antiserum raised against the PlpD C-terminal peptide NH2-EWLTRVQLGDRQELYSEFYQC-COOH at a 1:5000 dilution ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signal was detected using mouse anti-His antibody from Qiagen (Cat No./ID: 34660 1:500). Anti-mouse HRP was used for colorimetric development (Cat No./ID-A8924 1:1000) ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were used at the following dilutions: 1:1000 anti-penta-His mouse monoclonal (Qiagen), 1:5000 anti-cMyc mouse monoclonal (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-His Western blots were performed using Penta-His mouse monoclonal IgG1 as primary antibody (Qiagen, #34660) at 1:2000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins transferred to a nitrocellulose membrane were probed with a monoclonal anti-His6 antibody (Qiagen, Germantown, Maryland). Detection of proteins via Western blotting was performed by fluorescence detection using IR-Dye®-labeled fluorescent secondary antibodies and imaged using the Odyssey CLx Imager (LICOR Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: Antibodies and their conditions of use are as follows: mouse anti-His (Western blot, 1:1000; 34660; Qiagen), rabbit anti-Brl1 (Western blot ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Cell Biology 2022Quote: ... His- tagged human UHRF1 was purified using Ni-NTA sepharose resin (Qiagen). Recombinant E1 (His-UBE1) ...
-
bioRxiv - Genetics 2022Quote: RNA from human ileal biopsies was extracted using RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed to cDNA using TaqMan Reverse Transcription kit (#N8080234 ...
-
bioRxiv - Cell Biology 2022Quote: FASTQ files generated by sequencing human macrophages were imported into ArrayStudio (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were applied to the Human Aging RT2 Profiler PCR arrays (Qiagen) and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: Human islet RNA was extracted using the Qiagen RNeasy Kit (Qiagen; #74106) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: Human skin tissues were homogenized with RLT buffer (Qiagen, Hilden, Germany, 79216) supplemented with 1% β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for human ZMPSTE24 Hs_ZMPSTE24_1_SG QuantiTect) were predesigned and validated by QIAGEN and used diluted to a final work solution of 1x (QuantiTect Primers ...