Labshake search
Citations for Qiagen :
251 - 300 of 2076 citations for Human IgG1 Anti Dengue Virus NS1 Serotype 1 Antibody OB4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2021Quote: ... To generate a recombinant A_NS237 virus, viral RNA was extracted from allantoic fluid using Trizol reagent (Thermo Fischer, Germany) and Qiagen RNeasy Kit (Qiagen, Germany) following the manufacturers’ guidelines ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted from 300 µl of viral transport media (VTM, Himedia, India) using QIAamp 96 Virus QIAcube HT Kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: A 200 μL aliquot of Copan UTM® was processed through the QIAsymphony DSP Virus/Pathogen Mini Kit (Qiagen, Cat# 937036) following manufacturer’s instructions on the QIAsymphony SP instrument ...
-
bioRxiv - Molecular Biology 2020Quote: The RNA isolation was performed with 50 µl of the crude extract on the QIAsymphony with the DSP Virus/Pathogen Kit (Qiagen, #937055). The RT-PCR was performed using 5 µl of 85 µl eluate with TIB MolBiol Lightmix® MODULAR SARS AND WUHAN CoV E-Gene Kit ...
-
bioRxiv - Genomics 2020Quote: Viral RNA was extracted from nasopharyngeal swabs of patients with COVID-19 using the EZ1 DSP Virus Kit (Qiagen, Hilden, Germany), optimized for viral and bacterial nucleic acids extractions from human specimens using magnetic bead technology ...
-
bioRxiv - Microbiology 2021Quote: ... we collected the cell culture supernatants after 24 h of infection for viral RNA extraction with a QIAamp 96 Virus QIAcube HT Kit (Qiagen, 57731) and for viral RNA copy number detection in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from the lungs of influenza virus-infected mice using the RNeasy Mini Kit (QIAGEN, Cat. No 74004) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The followed antibodies and dilutions were used: Strep 1:1000 (Qiagen, 34850), PAF1 1:1000 (Bethyl Labs #A300-173A) ...
-
bioRxiv - Biophysics 2020Quote: ... the surface was incubated with 1 nM biotinylated penta-His antibody (Qiagen) in buffer A for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed overnight using a mouse monoclonal anti-StrepII antibody (Qiagen catalog number 34850) at a 1:2500-1:5000 dilution or a rabbit polyclonal antiserum raised against the PlpD C-terminal peptide NH2-EWLTRVQLGDRQELYSEFYQC-COOH at a 1:5000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... viral RNA was extracted from the egg-isolate of the virus from the nasal swab using the QIAmp viral RNA mini-kit without the addition of carrier RNA (Qiagen, Manchester, UK). cDNA was synthesized from RNA using a random hexamer primer mix and cDNA Synthesis System (Roche ...
-
Host transcriptomic profiling of COVID-19 patients with mild, moderate, and severe clinical outcomesbioRxiv - Genomics 2020Quote: RNA was extracted from nasopharyngeal swabs using the QIAamp Viral RNA Mini or the 213 EZ1 DSP Virus Kits (Qiagen, Hilden, Germany). All patients in this study tested positive for SARS-CoV-2 by RT-qPCR performed at Dubai Health Authority Hospitals ...
-
bioRxiv - Molecular Biology 2020Quote: ... The entire 200-µL reaction was used as input for ssAAV gDNA extraction using a MinElute Virus Spin Kit (Qiagen Cat#57704). 50-ng of ssDNA from each sample were bisulfite converted using the EZ Methylation Gold kit (Zymo Cat#D5005 ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from virus library and ferret nasal wash samples using the QIAamp® Viral RNA mini kit (Qiagen, Germany). Next generation sequencing was carried out twice on the nasal washes ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 RNA was purified using the QIAamp 96 virus QIAcube HT Kit and processed on the QIAcube robotic extraction platform (QIAgen, Hilden, Germany)
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Immunology 2019Quote: ... RNA was isolated from plasma samples using the QIAsymphony Virus/Bacteria Midi kit on the QIAsymphony SP automated sample preparation platform (Qiagen, Hilden, Germany). RNA was extracted manually if plasma volumes were limited ...
-
bioRxiv - Genomics 2020Quote: All 49 COVID-19 patients tested positive for SARS-CoV-2 by RT-qPCR using RNA extracted from nasopharyngeal swabs following the QIAamp Viral RNA Mini or the EZ1 DSP Virus Kits (Qiagen, Hilden, Germany). RNA libraries from all samples were then prepared for shotgun transcriptomic sequencing using the TruSeq Stranded Total RNA Library kit from Illumina (San Diego ...
-
bioRxiv - Immunology 2021Quote: ... Viral RNA was extracted from 200 ul of oral swab material using the Qiagen EZ1 DSP Virus kit on the automated EZ1 XL Advance instrument (Qiagen, Valencia, CA). Real-time quantitative reverse transcription – polymerase chain reactions (RT-qPCR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA and DNA were extracted from fecal and urine samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Valencia, CA, USA), but using 20μg of linear polyacrylamide (VWR ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was extracted from 200 ul of nasopharyngeal swab and BAL material using the Qiagen EZ1 DSP Virus kit on the automated EZ1 XL Advance instrument (Qiagen, Valencia, CA). Real-time quantitative reverse transcription – polymerase chain reactions (RT-qPCR ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from stock virus in allantoic fluid using the QIAamp Viral RNA Mini Kit (Qiagen Inc., Valencia, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... whereupon DNA was subsequently purified from 200 μl of the lysate using the QIAsymphony DSP Virus/Pathogen extraction kit (Qiagen Cat# 937036) on the QIAsymphony automated platform ...
-
bioRxiv - Molecular Biology 2023Quote: Total viral genomic DNA was extracted from 100 μL stored plasma samples with the QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany), according to manufacturers’ instructions ...
-
bioRxiv - Immunology 2024Quote: Virus RNA from in vitro or in vivo experiments was isolated using the QIAamp® Vira RNA Mini Kit (Qiagen, Germantown, MD) or the MagMAX-96 AI/ND viral RNA isolation kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from 1 mL of each human plasma sample using the DNeasy Blood and Tissue kit (Qiagen, 69504, Hilden, Germany) according to the manufacturer protocol and recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Viral nucleic acids were then isolated using the Qiagen QIAamp MinElute Virus Spin Kit without the use of AW1 buffer or carrier RNA (Qiagen, Valencia, CA, USA). Random hexamers were used to prime cDNA synthesis (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.