Labshake search
Citations for Qiagen :
301 - 350 of 10000+ citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from cultured from human bronchial epithelial cells / mice right lung tissues and purified using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany), supplemented with the Proteinase K (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from Amborella generative cells and sperm cells was extracted according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 ng of RNA from microdissected human pancreatic islets and from EndoC-βH1 was used to generate cDNA libraries using QiaSeq miRNA library kit (Qiagen, Hilden, Germany) following manufacturer’s instructions (see ESM Methods).
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS sorted mouse brain cells stabilized in RNAprotect buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...
-
bioRxiv - Microbiology 2022Quote: ... Pellicle biofilms (96 h) were homogenized with TissueLyser LT (QIAGEN, Germany) at 50 kHz for 10 mins ...
-
bioRxiv - Bioengineering 2023Quote: ... Total RNA was harvested at 96 h after treatment (RNeasy, Qiagen). MCL1 and PPIB (housekeeping ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lysate was cleared by centrifugation (35,000 x g, 1 h) and the supernatant was loaded onto a Ni-affinity chromatography column (Qiagen Ni-NTA Superflow, 20 mL) pre-equilibrated with Ni-NTA buffer ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: To synthesize cDNA from 1 μg RNA the Quantitect kit (Qiagen) was used according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: RNA (1 µg) was extracted with the RNeasy Kit (QIAGEN, 74106) and treated with DNase I following the manufacturer’s instructions (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... PCR#1 product was purified using Minielute PCR purification kit (Qiagen) and a second round of PCR amplification was performed with gene-specific primers R2 and forward F2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ml binding buffer (provided in Qiagen PCR purification kit, #28106) and 20 µl of 3 M sodium acetate pH 5.5 (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... from 1 x 107 cells using the RNeasy Mini Kit (Qiagen) and the TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 colonies using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). We used DNeasy Blood & Tissue Kits (QIAGEN ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Biophysics 2021Quote: ... Supernatant was collected for 2.5 h binding with Ni-nitrilotriacetic acid resins (Qiagen) at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After 8 h we isolated total RNA using a RNeasy Plus minikit (Qiagen). 384 TruSeq Stranded mRNA libraries were prepared in 96 sample batches ...
-
bioRxiv - Cell Biology 2022Quote: ... was performed approximately 24 h after cell plating using Effectene Transfection Reagent (Qiagen) with 1 µg siRNA in 742 µL transfection mixture ...
-
bioRxiv - Immunology 2020Quote: ... ConM-SOSIP.v7 carrying a C-terminal His-tag (diluted to 6.5nM in TBS) was immobilized onto 96-well Ni-NTA ELISA plates (Qiagen) by incubation for 2 hours at room temperature after which the plates were washed 3 times with TBS ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from 1 million cells with RNeasy mini Kit (Qiagen) following the manufacturer’s instructions and with DNase treatment on column ...
-
bioRxiv - Plant Biology 2021Quote: ... Genomic DNA (1 μg) isolated using a DNeasy plant mini kit (Qiagen) was used for library construction ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (1 μg) was was extracted using miRNeasy Mini Kit (Qiagen) and applied to either miR-based or mRNA based reverse transcription ...
-
bioRxiv - Microbiology 2020Quote: ... and IFN-stimulated DF-1 and CEF using the RNeasy kit (Qiagen) according to the manufacturer’s instructions as previously described48 ...