Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Human Eukaryotic Translation Termination Factor 1 ETF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: Supernatants from QFT and TruC tubes were analyzed for IFNγ by standard ELISA (Qiagen) and values were expressed in IU/mL ...
-
bioRxiv - Molecular Biology 2020Quote: The consensus sequences of piRNA biogenesis factors were assembled using CLC Genomics Workbench version 8.0.1 (QIAGEN) and confirmed by published homolog sequences using BLASTp ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transcription factor prediction was performed using i-cisTarget20 and the upstream regulator function by QIAGEN Ingenuity Pathway Analysis.21 Differentially expressed genes (DEGs ...
-
bioRxiv - Microbiology 2019Quote: ... 1 ml RLT buffer (Qiagen RNA Isolation Kit) + 10 μl β-mercaptoethanol was added and vortexed and a phenol chloroform extraction followed by an ethanol precipitation was carried out ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human U6 primer used in this experiment was included in the miScript Primer assay kit (Qiagen Inc., Germantown, MD, #218300).
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was isolated from human buffy coat samples at the Crimson Core facility (Mass General Brigham) using the QIAamp DNA Blood Mini Kit (Qiagen 69504) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Reference plasmids were serially diluted in either PBS buffer or heat-inactivated normal human serum (NHS) and re-extracted using the QIAamp® DNA Blood Mini Kit (Qiagen) per recommended protocol for serum ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted from human cell lines of WI-38 and MED13LS1497F using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... 1 µg of RNA isolated from human islets or 10 µL of exosomal RNA was reverse transcribed using the miRScript II kit (Qiagen, Germany), following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... gracilis (1 male and 1 female) using the Rneasy Mini Plant Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from cultured from human bronchial epithelial cells / mice right lung tissues and purified using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany), supplemented with the Proteinase K (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from Amborella generative cells and sperm cells was extracted according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 ng of RNA from microdissected human pancreatic islets and from EndoC-βH1 was used to generate cDNA libraries using QiaSeq miRNA library kit (Qiagen, Hilden, Germany) following manufacturer’s instructions (see ESM Methods).
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS sorted mouse brain cells stabilized in RNAprotect buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Cell Biology 2022Quote: The heatmaps relative to the ERK-dependent AP-1 target genes were generated by interrogating the Transcription Factor Target (TFT) collection (MSigDB) and TF binding site database by QIAGEN with the top DEGs between control and PD-treated Acomys ...
-
bioRxiv - Cell Biology 2019Quote: ... The copy number of standard DNA molecules was then determined by the following formula (from the script “Critical Factors for Successful Real Time PCR”, Qiagen):
-
bioRxiv - Immunology 2020Quote: Differentially activated biological pathways and upstream regulators were assessed for model factors of interest using the Ingenuity Pathway Analysis software (IPA; QIAGEN Inc. ...