Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Human CD120b ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using miRCURY LNA miRNA Human Panel I according to manufacturer’s instructions (Exiqon/Qiagen). The data was analyzed using GenEX software (MultiD ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: Human cancer stem cells RT2 Profiler PCR arrays were purchased from Qiagen (Cat# PAHS-176ZA-12) and used in combination with a 7900 HT real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... while rodent and human samples were eluted in 100 µl of buffer AE (Qiagen, Hilden, Germany). Samples were stored at −20°C before PCR.
-
bioRxiv - Immunology 2020Quote: ... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Targets were included if biochemically confirmed using human tissue or non-species methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from purified human T cells using the RNeasy Plus Minikit (Qiagen, Germantown, MD). 0.5 μg Donor B RNA was mixed with 4.5 μg Donor A RNA to create sample C for quantitation experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... and human induced astrocytes (>day 30 of differentiation) were harvested in RLTplus Lysis buffer (Qiagen, 1053393). Total RNA was isolated using the RNeasy micro/mini plus kit (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... and aligned to a human reference sequence GRCh38/hg38 by using CLC Genomics Workbench v20 (Qiagen). The TPM (transcript per million ...
-
bioRxiv - Microbiology 2019Quote: ... kit (Qiagen). Phylogenetic groups were determined as described in (Clermont ...
-
bioRxiv - Microbiology 2019Quote: ... Kit (QIAGEN) followed with 16S-ITS PCR as previously described (64 ...
-
bioRxiv - Genetics 2020Quote: ... Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Kit (Qiagen). Whole-genome sequencing was performed using the Illumina Nextera XT library protocols and sequenced at 2 x 300bp read length on the MiSeq platform (Ramaciotti Centre for Functional Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... Kit (Qiagen) using 5 mL culture of V_227 which was grown in MMT-YE medium (20°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The kits for RNA extraction were from Qiagen (RNeasy Mini Kit and RNeasy Micro Kit). The reverse transcription kit ...
-
bioRxiv - Neuroscience 2021Quote: ... Using a commercial kit (QIAGEN DNeasy isolation kit #69506), DNA was isolated from a tissue punch taken from the external ear ...
-
bioRxiv - Microbiology 2023Quote: ... using a commercial kit (RT2 First Strand Kit, Qiagen). Quantification of transduction of EBECs and HBECs with the SARS-CoV-2 pseudovirus was determined by real-time qPCR (rt-PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and the RNeasy kit plus Mini kit (#74134, Qiagen) or using NucleoSpin RNA Plus XS ...
-
bioRxiv - Neuroscience 2020Quote: ... frozen fragments of human cortex were homogenized with a motorized hand pestle in RLT lysis buffer (Qiagen) and qPCR was performed as described in qPCR section.
-
bioRxiv - Microbiology 2019Quote: ... The RT2 Profiler “Inflammatory cytokines and receptors” and “Human innate and adaptive response” arrays PCR Arrays (Qiagen) were performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Two mouse and two human stool samples were homogenized using a PowerLyzer 24 Homogenizer (110/220V; Qiagen). DNA was extracted using four different bead beating times ...
-
bioRxiv - Cell Biology 2022Quote: ... Human ATGL-targeting and cPLA2α-targeting siRNAs and the AllStars Negative Control siRNA were from Qiagen (Germany). T863 (DGAT1 inhibitor) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Rattus norvegicus reference genome Rnor_6.0) or the human reference genome (Homo sapiens reference genome GRCh37) using CLC Genomics Workbench 20.0.4 (Qiagen). Only reads with <2 mismatches and minimum length and a similarity fraction of 0.8 were mapped to the reference genome ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet was lysed using RLT buffer (mouse cells) or QIAZol (human cells) (Qiagen, Cat. 79306). RNA was extracted using the Qiagen RNeasy micro kit.
-
bioRxiv - Genetics 2019Quote: ... DNA maxiprep kit was from Qiagen (EndoFree Plasmid Maxi Kit). All plasmids were cloned with Gibson assembly (42 ...
-
bioRxiv - Cell Biology 2021Quote: ... QIAquick PCR purification kit or QIAquick Gel Extraction kit (Qiagen). Cloning strategies for each construct are described in Table S1 ...
-
bioRxiv - Genetics 2022Quote: ... we used the QIAGEN kit (DNeasy Blood & Tissue Kit; Qiagen, https://www.qiagen.com/ ...
-
bioRxiv - Neuroscience 2024Quote: ... QIAfilter Plasmid kits (Midi prep kit; Qiagen; catalog no.: 12243) were utilized to purify plasmid DNAs following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Kit (Qiagen, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Transcription kit (Qiagen) and prepped for RT-PCR using PIPETMAX (Gilson ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription Kit (QIAGEN). qPCR was performed on the StepOne™ system (Applied Biosystems ...