Labshake search
Citations for Qiagen :
1 - 50 of 1828 citations for Human β Amyloid 1 42 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Neuroscience 2022Quote: ... 28 and 42 using the RNAeasy Plus Mini Kit (Qiagen). cDNA was synthesized using 1 µg of RNA per sample according to manufacturer’s instructions (Omniscript RT kit ...
-
bioRxiv - Microbiology 2022Quote: ... 25% (w/v) PEG 1500 (QIAGEN PACT screen, condition 42).
-
bioRxiv - Genomics 2024Quote: ... 72 °C for 1 min and then subjected to a 1.2x SPRI cleanup eluting in 42 µl EB buffer (Qiagen). Each sample was split into two fractions and each of them was further amplified with modality-specific primers ...
-
bioRxiv - Physiology 2021Quote: ... and 1% β-mercaptoethanol with a TissueLyser II (Qiagen, Manchester, UK) at maximum speed for 2 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... containing 10μl of 1% v/v β-mercaptoethanol TCL buffer (Qiagen # 1031576) using a BD AriaII cell sorter ...
-
bioRxiv - Genomics 2021Quote: ... These leftover materials were collected by LCM and placed into 350 μl of RLT lysis buffer (RNeasy, Qiagen, including 1%β-Mercaptoethanol (β-Me)) followed by RNA extraction and examination with the 2100 Bioanalyzer.
-
bioRxiv - Molecular Biology 2020Quote: ... 200ul and 600ul Buffer RLT (containing 1% β-mercaptoethanol, QIAGEN RNeasy Mini Kit) was added to nuclear and cytosolic fractions respectively and vortexed vigorously ...
-
bioRxiv - Cancer Biology 2023Quote: ... + 1% β-mercapto-ethanol and RNA was purified using the RNeasy kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 1% β-mercaptoethanol and homogenized using a bead mill (Qiagen TissueLyser LT). RNA was purified using the Qiagen RNeasy Mini kit with DNase (Macherey-Nagel ...
-
bioRxiv - Microbiology 2020Quote: ... and miR-42-3p were obtained from the miScript Primer Assays kit (Qiagen). miR-47-3p was used as the endogenous control ...
-
bioRxiv - Immunology 2022Quote: ... with β-mercapto-ethanol (1:100) and RNA was extracted using RNeasy micro kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Cell Biology 2019Quote: ... Total RNAs were prepared in RLT RNA lysis buffer supplemented with 1:100 β-mercaptoethanol (Qiagen) at 5,000 cells/µl ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: Bulk or flow-sorted THP-1 macrophages were lysed with β-ME-supplemented Buffer RLT (Qiagen). RNA was isolated from the lysate using an RNEasy plus kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... incubated for 45min at 42°C and the reaction purified with 15µl of MagAttract beads (Qiagen). The labelled DNA was eluted with TE-buffer (10mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in Buffer RLT + β-mercaptoethanol (Qiagen), snap frozen on dry ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer RLT + β-mercaptoethanol (Qiagen), and snap-frozen on dry ice ...
-
bioRxiv - Immunology 2020Quote: ... β-actin (pre-designed primers from Qiagen); HPRT(Eun et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... or RLT-Buffer with β-mercaptoethanol (Qiagen). Parasite RNA was isolated with the RNeasy Kit (Qiagen ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: ... were added to each sample tube together with 400μL a 1% β-mercaptoethanol in RLT buffer (Qiagen) and 2μL of antifoam agent (ID 19088 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were sorted in RTL Lysis Buffer plus 1% β-mercaptoethanol (74134, RNeasy Plus Mini Kit; QIAGEN), or in sterile Sorting Medium [RPMI 1640 supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... 12,000 GFP+ nuclei were collected into cold Buffer RLT Plus supplemented 1:100 with β-mercaptoethanol (Qiagen, 74034) using the Sony SH800S Cell Sorter (purity mode ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Molecular Biology 2021Quote: A plasmid containing the modified Widom 603–42 sequence31 was purified with a QIAquick PCR Purification Kit (Qiagen) and used as the template for the amplification.
-
bioRxiv - Microbiology 2022Quote: High-titer lysates of all phages were prepared by confluent lysis (42) and purified (Lambda Midi Kit, Qiagen). DNA content of samples was quantified (Quant-iT DNA assay kit ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: ... after which a second volume of 400μL a 1% β-mercaptoethanol in RLT buffer (AllPrep DNA/RNA Minikit, Qiagen) was added after steel bead removal ...
-
bioRxiv - Microbiology 2022Quote: Frozen tissue was partially thawed and submerged in lysis buffer containing 1% β-mercaptoethanol and 0.5% Reagent DX (Qiagen) before tissues were homogenised together with TissueRupture (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... cDNA were purified with 1.8X volume AMPure XP Beads and eluted into 42 μl nuclease free water (129114, Qiagen). Next ...
-
bioRxiv - Neuroscience 2022Quote: ... that open in old aNSCs freshly isolated from the SVZ were uploaded to Ingenuity Pathway Analysis (IPA) (v1.16)42 (QIAGEN Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Profiling of TGF-β targets was performed using the RT2 Profiler™ PCR Array Pig TGF-β Signaling Targets kit from Qiagen following manufacturers’ instructions.
-
bioRxiv - Developmental Biology 2019Quote: ... containing β-mercaptoethanol and the RNeasy Mini kit (Qiagen) followed by in-column DNase I treatment to remove genomic DNA contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... Buffer RLT with β-mercaptoethanol (Qiagen RNeasy Micro Kit) was added to the samples immediately after the last wash and tubes were vortexed to release the polysomes from the beads ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μM gene specific primers pairs (hVDAC1, hVDAC2, hVDAC3, β-actin (Table 1) and 12.5 μl of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Three independent experiments of quantitative real-time were performed in triplicate for each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... brain hemispheres were homogenized in freshly prepared lysis buffer (0.6 ml per 30 mg of brain tissue) containing 1% β-mercaptoethanol using a TissueRuptor homogenizer (Qiagen).
-
bioRxiv - Cancer Biology 2022Quote: ... Pathway analysis of genes adjacent to identified tissue and cell-type specific methylation blocks was performed using Ingenuity Pathway Analysis (IPA)(42) (Qiagen) and Genomic Regions Enrichment of Annotations Tool (GREAT)(43) ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from three independent samples of mesophyll- and bundle sheath-enriched tissues collected at seven time-points (42 samples) using RNeasy Plant Mini Kit (Qiagen). To eliminate residual genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Immunology 2021Quote: ... 30mg of whole spleen RNA was extract via 30 second homogenization in RLT lysis buffer containing 1% β-mercaptoethanol per RNeasy kit (Qiagen). RNA was reverse transcribed into cDNA using iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Immunology 2022Quote: ... macrophages were lysed with 300μL lysis buffer with 1% v/v β-mercaptoethanol (Themo #12183025) and passaged through a QIAshredder homogenizer column (Qiagen #79656). Total RNA was isolated (Themo #12183025 ...
-
bioRxiv - Cell Biology 2020Quote: ... 350μL RLT buffer supplemented with 1% pure β-mercaptoethanol were added and the cell slurry was transferred onto a QIAshredder spin column (Qiagen). Subsequently ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... B220+Fas+CD38- CD45.1+ or CD45.1-) were sorted from immunized recipients directly into RLT buffer supplemented with 1% β-ME (Qiagen, Hilden, Germany). mRNA was extracted with an RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissue lysis was performed by re-suspending ∼30mg of sliced frozen tissue in a solution containing 1% β-mercaptoethanol in RLT buffer (supplemented with antifoam agent; ID 19088, Qiagen). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed in ice-cold PBS and resuspended in 350μl of Buffer RLT Plus supplemented with 1% (v/v) β-mercaptoethanol from the RNeasy Plus Mini Kit (Qiagen, 74134). RNA was extracted using the same kit according to manufacturer’s instructions and quality was assessed using the Agilent 2200 TapeStation System (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were suspended in RNeasy kit Lysis Buffer and β-mercaptoethanol (1:100 v/v) and homogenized using QIAshredder columns (Qiagen). Samples loaded on spin columns were treated with DNase (Qiagen ...