Labshake search
Citations for Qiagen :
601 - 650 of 3061 citations for Glyphosate Chemical Purity 96% 2 13C 99%; 15N 98+% 100 Ug Ml In H2O since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... RNA purification was carried out using the RNeasy Plus 96 kit (74192) (Qiagen, Venlo, The Netherlands) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using a MinElute 96 UF PCR Purification Kit (Qiagen, Valencia, CA, USA). Libraries were sequenced (1 x 300 bases ...
-
bioRxiv - Microbiology 2020Quote: ... viral RNA was extracted from apical washes using the QIAamp 96 Virus QIAcube HT Kit (QIAGEN). The SARS-CoV-2 genome was amplified using a highly multiplexed tiling PCR reaction based on the ARTIC protocol (https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w ...
-
bioRxiv - Microbiology 2021Quote: Total DNA was extracted from frozen fecal samples using the DNeasy PowerSoil HTP 96 kit (Qiagen). Barcoded primers were used to amplify the V3-V4 region of the 16S rRNA gene using 515f and 806r primers ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicon clean-up was performed using the Ultra Clean 96 well PCR Clean Up kit (Qiagen) prior to fluorescent quantification of DNA yield (Quant-iT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of DNA was bisulfite-treated using the EpiTect 96 Bisulfite Kit (Qiagen GmbH, Germany). 200 ng of bisulfite-treated DNA was analysed using Infinium HumanMethylation 450K BeadChips (Illumina Inc. ...
-
bioRxiv - Genomics 2019Quote: ... Genomic DNA was extracted using Qiagen DNeasy 96 Blood & Tissue kits (Qiagen Ltd., Mississauga, ON, Canada). Paired-end library preparation was conducted using the TruSeq DNA PCR-free protocol (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were purified using the MinElute 96 UF PCR Purification Kit (Qiagen, Valencia, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using a QIAGEN DNeasy® 96 Blood and Tissue Kit (Qiagen®, UK) as per the manufacturers protocol[52] with DNA eluted in 45μL of buffer AE ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... individual total DNA was extracted from leaf material from each individual using BioPrint 96 (Qiagen, Germany), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified using a MinElute 96 UF PCR Purification Kit (Qiagen, Valencia, CA, USA). Libraries were sequenced (2 x 300 bases ...
-
bioRxiv - Genetics 2020Quote: ... DNA was cleaned using a modification of the Qiagen DNeasy 96 Plant kit (Qiagen, Germantown, MD), diluted to 20ng/μl ...
-
bioRxiv - Microbiology 2022Quote: Cells were lysed in RLT buffer and RNA was extracted using a RNeasy 96 kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were extracted from specimens using QIAamp 96 Virus QIAcube HT Kit (Qiagen, Hilden, Germany), QIAamp Viral RNA Mini Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and placed in a well of 96-well plate containing 2,5µl of RLT plus buffer (Qiagen). At the end of cell collection ...
-
bioRxiv - Genomics 2023Quote: ... and the BioSprint 96 one-for-all Vet Kit utilizing ASL buffer (19082; Qiagen, Germantown, MD) and bead beating ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Influenza viral RNA extraction was performed using a custom QIAamp 96 DNA QIAcube treated kit (Qiagen) with a high-throughput automated liquid handler-QIAcube HT (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 9 mL 1M Tris HCl pH 7.5, 9 mL 0.5M EDTA pH 8.0, 11.25 mL 10% SDS, 22.5 mL Qiagen lysis reagent ...
-
bioRxiv - Neuroscience 2021Quote: ... Triton X-100 and Vapor-Lock (Qiagen). The MoFlo XDP Cell Sorter was calibrated for dispensing the single cells in the centre of each well prior to sorting and the machine was run using trigger pulse width to exclude doublets ...
-
bioRxiv - Cell Biology 2020Quote: ... with 100 nM YWHAG siRNA (Qiagen SI00100653) or Silencer Select™ non-targeting control 2 (SS2 ...
-
bioRxiv - Microbiology 2024Quote: BC3 cells were treated with indicated chemicals for 65h and total DNA was purified from cell lysates using the FlexiGene DNA kit (Qiagen). Intracellular viral DNA was measured by real-time quantitative (q ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pyrosequencing of PCR products was performed on PyroMark Q 96 MD using the PyroGold Reagent Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: One µg of DNA was bisulfite-treated using the EpiTect® 96 Bisulfite Kit (Qiagen, Hilden, Germany) and analysed using the Infinium Human Methylation 450K BeadChips (Illumina ...
-
bioRxiv - Genetics 2020Quote: DNA was extracted from hair follicles using a Quaigen DNeasy 96 Blood & Tissue Kit (QIAGEN, Manchester, UK), following the Purification of Total DNA from Animal Tissues DNeasy 96 Protocol (Handbook ...
-
bioRxiv - Genomics 2021Quote: ... baumannii isolates with the QIAamp 96 DNA QIAcube HT kit and a QIAcube HT (Qiagen; Hilden, Germany). DNA extracts were multiplexed and sequenced on the Illumina HiSeq platform (Illumina ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from -80°C stored stool samples using the DNeasy Powersoil HTP 96 kit (Qiagen) and an EpMotion 5075 automated pipetting system (Eppendorf) ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: ... All the PCR products were then purified with the QIAquick 96 PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or head and bodies separately for blood-fed mosquitoes) using the RNeasy 96 QIAcube HT kit (Qiagen). DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master ...
-
bioRxiv - Genomics 2021Quote: ... before proceeding to DNA purification using a BioSprint DNA Blood Kit on a BioSprint 96 Workstation (Qiagen), using protocol “BS96 DNA Tissue” as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and genomic DNA was purified using the 96-well high-throughput DNeasy Blood and Tissue kit (Qiagen). Array-based genotyping was performed on the resulting genomic DNA.
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted from artificial gut and stool samples using a 96-well PowerSoil kit (Qiagen #12888). For all samples ...
-
bioRxiv - Microbiology 2019Quote: ... DNA extractions were performed using a DNeasy PowerSoil 96-well plate DNA extraction kit (Qiagen, Hilden, Germany). The standard protocol was used with the following two exceptions ...
-
bioRxiv - Immunology 2020Quote: ... cells were stained as above and index-sorted directly into 96 well plates containing Buffer TCL (Qiagen) supplemented with 1% β-mercaptoethanol using a BD FACS Aria II ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from blood-fed females using standard protocols (Qiagen DNeasy 96 blood and tissue kit). For each individual ...
-
bioRxiv - Microbiology 2020Quote: ... The extraction tubes were then agitated twice in a 96-well plate using Tissue lyser II (Qiagen) at 30 Hz/s for 5 min.
-
bioRxiv - Immunology 2020Quote: ... Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... powdered liver (~10 mg) was resuspended in 900 μL QIAzol (RNeasy 96 Universal Tissue Kit, Qiagen, 74881) and homogenized at 25/s for 1 min at 4°C using a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: RNA purification from both IPSC and primary mouse cortical cultures were done using RNeasy 96 Kit (Qiagen) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was isolated from parental lines and F2 populations using the DNeasy Plant Kit 96 (Qiagen) and diluted to a final concentration of 25 ng/μL ...
-
bioRxiv - Genomics 2022Quote: Viral RNA was extracted from 200 μl of clinical sample using QIAamp 96 Virus QIAcube HT (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... at 300 cells per well into 96 well LoBind plates containing 5 μL of EB buffer (Qiagen). After sorting ...
-
bioRxiv - Microbiology 2023Quote: ... aureus and 4 food-derived Staphylococcus bacteria were extracted using the DNeasy 96 Blood & Tissue kit (Qiagen). For sequencing analysis ...
-
bioRxiv - Systems Biology 2023Quote: The amplified vectors were extracted from the inoculated culture with Plasmid Plus 96-well Miniprep kit (Qiagen). The concentration was measured with a Nanophotometer and diluted to 100 ng/µl ...
-
bioRxiv - Systems Biology 2023Quote: The amplified vectors were extracted from the inoculated culture using Plasmid Plus 96-well Miniprep kit (Qiagen). The concentration of each vector was measured with a Nanophotometer and diluted to 100 ng/µl ...