Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Glucose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Physiology 2022Quote: ... Using the Neuronal ion channel plate (Qiagen, UK), 84 ion channels as well as housekeepers were measured in each sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and released into a PyroMark Q24 plate (Qiagen) pre-loaded with 0.3μM of sequencing primer ...
-
bioRxiv - Genetics 2023Quote: ... plates were shaken on a TissueLyser II (Qiagen) at 900 rpm (15 rps ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were performed in a total volume of 20 μL using Rotor-Gene Q Detection System (Qiagen), setting the excitation wavelength to 470 nm and detecting emission at 557 nm of the SYPRO Orange protein gel stain ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Physiology 2019Quote: Total RNA was prepared by lysing cell pellets (2×106) in 700 μl Qiazol and extracted using Qiagen miRNeasy mini kit according to the manufacturer’s recommendation (Qiagen Inc, CA, USA) from the same samples (n=54) ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated from whole blood (2.5mL) thawed at room temperature for 2 hours prior to using the PAXGene RNA extraction kit (Qiagen, Chatsworth, CA, USA) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 2 μg/lane which gave the best separation was scaled up for extraction using QIAquick Gel Extraction Kit (Qiagen cat# 28704).
-
bioRxiv - Genetics 2021Quote: ... and 200-500 bp fragments were extracted from a 2% agarose gel after electrophoresis and purified using a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified DNA was PCR amplified using 2× GoTaq Colorless Master Mix (Promega ...
-
bioRxiv - Immunology 2021Quote: ... The dried DNA pellet was reconstituted in 50 μL H2O treated with 330 μg/mL of RNase A for 2 hours at 37°C and then recovered using the QIAquick PCR Purification kit (QIAGEN Cat#28104). DNA concentration was determined by Qubit (Thermofisher).
-
bioRxiv - Microbiology 2020Quote: We evaluated the impact of using Nanotrap particles to capture and concentrate SARS-CoV-2 on several nucleic acid extraction methods: the QIAamp® Viral RNA Mini Kit from QIAGEN (52906); the RNeasy® Mini Kit from QIAGEN (74106) ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from root tips (~2 mm) in three biological replicates for each genotype using RNeasy plant mini kit (QIAGEN, http://www.qiagen.com). Approximately 300 root tips from 6-days-old plants were collected for each sample ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 21 and 28 days post inoculation (dpi) and 2 μg was used to synthesize cDNA using the QuantiTect® Reverse Transcription Kit (Qiagen, CAD) following the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ligated DNA fragments ranging in size from 300 to 450 base pairs (bp) were extracted from 2% low-melt agarose gels and purified using a MinElute gel extraction kit (Qiagen, Valencia, CA). The recovered fragments were amplified using PCR ...
-
bioRxiv - Genetics 2021Quote: ... in length were extracted from a 2% agarose gel after electrophoresis and purified using a Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany). The purified DNA was PCR amplified using GoTaq Colorless Master Mix (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-5 μg of DNA was isolated from frozen cortex of 2- and 12-month-old mice according to the manufacturer’s protocol (DNeasy Blood & Tissue Kit, Qiagen, Cat No. 69504) and diluted with 10 mM Tris ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 RNA from the apical washes of the ALI HBE culture was isolated using QIAamp Viral RNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Genomic DNAs of 61 weaned pups (2 pups died before weaning) were collected from their tails with a DNeasy Tissue kit (Qiagen, Valencia, CA). Six Ptger3-tTA BAC transgenic founder rats were identified by PCR for the presence of the tTAad-BGH insert ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA for the Pacific Bioscience Single Molecule Real-Time (SMRT) sequencing was prepared from 2 mL of fresh blood using the genomic-tip 100/G kit (Qiagen, Hilden, Germany). This was performed with additional RNase (Astral Scientific ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted directly from the frozen samples with the addition of 2 ml of G2 DNA/RNA Enhancer (Ampliqon, Odense, Denmark) using the RNeasy PowerSoil Total RNA Kit (Qiagen, København, Denmark) with phenol:chloroform:isoamyl alcohol following the manufacturer’s instructions ...
-
bioRxiv - Zoology 2023Quote: ... PCR products were amplified on a 2% agarose gel and amplicons were excised and cleaned using a gel purification kit (Qiagen, Hilden, Germany). Purified DNA was sequenced using both forward and reverse primers and Big Dye Terminator Cycling Sequencing at Azenta LLC (Plainfield ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of approximately 0.2 g of biomass pellets were further used for mDNA extraction also with the PowerLyzer® PowerSoil® DNA Isolation kit (QIAGEN).
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was treated with proteinase K at 42°C for 2 hrs and purified using MinElute PCR Purification Kit (Qiagen, Cat# 28004).
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 1-2×104 sorted alveolar epithelial cells isolated from cryopreserved lung parenchyma from 11 different donors using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit, Qiagen Germantown, MD, USA) and ran them in the tissue lyser at either ½ speed or max speed for 30 sec or 1 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Final PCR products of 250–500 bp were excised from a 2% agarose gel and purified using a gel purification kit (Qiagen, Catalog # 28604) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2019Quote: ... with two sets of 96-well adapter plates (QIAGEN) containing 2 ml microcentrifuge tubes (QIAGEN ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was loaded with a QIAgility Robot (Qiagen) and run on 7500 Fast Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...
-
bioRxiv - Microbiology 2019Quote: ... Detection of Wolbachia was carried out by real-time PCR on a Rotor-Gene Q machine (Qiagen, Australia) using strain-specific primers and probes ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... transferred to the laboratory (within 2 hours) on ice and immediately processed for DNA extraction using the DNeasy PowerSoil kit (Qiagen, Valencia, CA, USA) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Microsatellites were co-amplified in multiplex PCR (Table 2) with a Thermocycler T Gradient machine (Biometra, Goettingen, Germany) using the Qiagen® Multiplex PCR Kit (Qiagen, Hilden, Germany). Forward primers were 5’-labeled with fluorescent dyes HEX ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA extraction was performed from 25 mg (±2 mg) of arthropod powder with Qiagen Dneasy® Blood & Tissue extraction kit (Qiagen, Hilden – Germany) following the manufacturer’s protocol (see Sire et al ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Genomics 2020Quote: ... 80 µl of Viral Transport Media that had previously stored a nasopharyngeal swab from a patient infected with SARS-CoV-2 were used for RNA isolation using the QIAamp Viral RNA Mini spin kit (Qiagen, Cat No./ID: 52904) according to manufacturer specifications ...