Labshake search
Citations for Qiagen :
201 - 250 of 539 citations for GSK3B siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... pooled STAT3 siRNA (Qiagen, #FlexiTube GeneSolution GS6774); scrambled siRNA (Dharmacon ...
-
bioRxiv - Cancer Biology 2019Quote: AllStars Negative Control siRNA (1027281, Qiagen, UK); Hs_ATF4_9 FlexiTube siRNA (SI04236337 ...
-
bioRxiv - Molecular Biology 2020Quote: ... “Allstars negative control siRNA” was from Qiagen. Cells were transfected for 48 h with 50 nM siRNA using Dharmafect 1 reagent (Dharmacon) ...
-
bioRxiv - Cell Biology 2019Quote: RPE1 cells were transfected with siRNAs (Qiagen) using lipofectamine RNAi Max transfection reagent (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lipofectamine and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6 ...
-
bioRxiv - Cell Biology 2020Quote: ... or AllStars Negative Control siRNA duplex (Qiagen) at a concentration of 50 nM ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Neuroscience 2019Quote: ... andAllStars Negative Control Scrambled siRNA (Qiagen #SI03650318) was performed similarly to make a 20uM stock instructions provided ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The AllStars negative-control siRNA from Qiagen was used as control siRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... A random control siRNA (#1027281; Qiagen, UK) was used as the control ...
-
bioRxiv - Cell Biology 2021Quote: ... and AllStars negative control siRNA 1027281 (Qiagen).
-
bioRxiv - Cancer Biology 2020Quote: ... siRNA was obtained from Qiagen (Hilden, Germany). Cell culture reagents and flasks were purchased from HiMedia (France ...
-
bioRxiv - Cancer Biology 2022Quote: ... as well as control siRNA (SI03650325, QIAGEN), were transfected into cells using HiPerFect Transfection Reagent (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... siRNAs were purchased from Qiagen (Germantown, MD) or Thermo Fisher Scientific (Ambion ...
-
bioRxiv - Microbiology 2022Quote: ... we obtained FlexiTube GeneSolution siRNA sets (Qiagen), comprising four unique ...
-
bioRxiv - Cell Biology 2022Quote: ... Negative control siRNAs were from Qiagen (#1022076), and SQLE siRNAs from Horizon (#L-009646-00-0005 ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Negative Control siRNA (Cat# 1027310, Qiagen) were reverse-transfected using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following siRNAs were used from QIAGEN: Scrambled siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genetics 2023Quote: ... The AllStars Negative Control siRNA (1027281, QIAGEN) was used for NONsi.
-
bioRxiv - Cancer Biology 2023Quote: ... All the siRNAs were purchased from Qiagen. We used two pooled siRNAs for PARP-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AllStars negative-control siRNA from Qiagen was used as control siRNA.
-
bioRxiv - Molecular Biology 2023Quote: ... The All-Star negative control siRNA (Qiagen) was used as a control ...
-
bioRxiv - Immunology 2021Quote: A549 cells were transfected with TMPRSS2 siRNA or control siRNA by using Effectene Transfection Reagent (Qiagen, Hilden, Germany, B00118) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The siRNA library that contained 90 siRNA targeting 45 genes of interest was custom synthesized by Qiagen (Table S3).
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Genetics 2020Quote: ... and cells treated with transfection mix without siRNA (Wild type (WT)) or non-targeting control siRNA (scrambled (SCR)) (Qiagen catalog SI03650318 ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-targeting siRNA controls contained 20 nM (for ATGL) or 40 nM (for cPLA2α) AllStars Negative Control siRNA (Qiagen). Transfection complexes were generated using 1 μL/well Lipofectamine RNAiMAX in 24-well plates ...
-
bioRxiv - Cell Biology 2019Quote: ... human primary monocytes were transfected with 200 nM of ON-TARGETplus SMARTpool siRNA targeting Siglec-1 (Horizon Discovery) or non-targeting siRNA (control) using HiPerfect transfection system (Qiagen). Four hours post-transfection ...
-
bioRxiv - Genomics 2019Quote: ... Briefly, mouse ESCs treated with non-targeting control siRNA (Dharmacon, D-001810-02-50)or NF-YA siRNA (Qiagen, SI01327193) were collected 48 hours post-transfection in cold PBS ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with siRNA at 30 nM (total for four siRNAs) concentrations mixed with HiPerfect Transfection Reagent (#301704, Qiagen) according to the manufacturer’s reverse transfection protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Our studies involving siRNA-mediated knockdown were performed in HUVE cells transfected with 50 nM of siRNA against CD98hc or scrambled siRNA duplex (QIAGEN). Wild type and mutant construct overexpression studies were done in HUVE cells seeded on glass bottomed 8-well chamber slides ...
-
bioRxiv - Cell Biology 2019Quote: ... GGA family member and interactor targeting siRNAs (Oligo IDs indicated in Fig. S1A) and control siRNA were purchased from Qiagen. Before plating MDA-MB-231 cells on CSMA ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... H460 and H2023 cells 48 hrs following transfection with control siRNA or NRF2 siRNA (cat. no. HSS107128 and HSS107130) using the RNeasy Mini Kit (Qiagen). Cells treated with the control siRNA were analyzed in biological duplicates ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Molecular Biology 2023Quote: Primary monocytes were cultured in 24-well plates and then transfected with control non-targeting siRNA (Dharmacon) or siRNA targeting ERN1 (Dharmacon) using HiPerFect reagent (QIAGEN) following the instructions provided by the manufacturer ...
-
bioRxiv - Biochemistry 2023Quote: ... HBEC5i cells with treated with either non-specific siRNA or Flvcr2 siRNA were harvested and kept in 1 mL TRI reagent (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Immunology 2023Quote: ... MRC-5/hTERT or A549 cells were reverse transfected with ON-TARGETplus siRNA SMARTpools (Horizon Discovery) or FlexiTube siRNA (Qiagen) using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... AllStars Hs Cell Death siRNA (Cat# 1027298, Qiagen) was used as a positive control for transfection efficiency ...