Labshake search
Citations for Qiagen :
301 - 350 of 539 citations for GRM4 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: Non-targeting siRNA was purchased from Qiagen (Venlo, Netherlands) and TFG targeting siRNA duplexes (individual siGENOME grade ...
-
bioRxiv - Biochemistry 2022Quote: ... TIMM44 and negative control siRNA (QIAGEN SI03125969 and 1022076) were transfected at 20 nM using jetPRIME reagent (Polyplus 114-07 ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Cell Biology 2022Quote: ... MicroRNA mimics and siRNA pools were purchased from Qiagen GmbH (Germany ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... si-control (Allstars Negative Control siRNA; Qiagen, cat# 1027281), si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Biochemistry 2021Quote: ... The following siRNAs were used: negative ctrl (Qiagen 1027281), CFIm25-si1 (Qiagen SI04414732) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cells were transfected with HiPerfect and 3 µl of 10 µM ERK4 siRNA from Santa Cruz Biotechnology (sc-62280) or control siRNA from Qiagen (1027280). After 48 h ...
-
bioRxiv - Cell Biology 2022Quote: ... pools of three siRNA per target were purchased (Qiagen) and the cell were transfected with Hyperfect (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: siRNAs used in this study were purchased from Qiagen and transfected with HiPerFect (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... non-targeting AllStars Negative Control siRNA (Qiagen Hilden, 1027281) was used.
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with Allstars Negative Control siRNA (QIAGEN). For CLIP-170 + EB3 depletion experiments ...
-
bioRxiv - Physiology 2023Quote: ... siRNAs were diluted in 12.5% HiPerFectct Transfection Reagent (QIAGEN) in OptiMEM (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with Mena and VASP siRNA (Qiagen SI00051373 ...
-
bioRxiv - Cell Biology 2023Quote: ... Tmem173 siRNA was purchased from Qiagen (catalogue-number GS72512).
-
bioRxiv - Cancer Biology 2023Quote: ... AllStars negative control siRNA was purchased from Qiagen (1027281). The sense strand sequences of the siRNAs are listed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA transfections were performed essentially using Hiperfect reagent (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used the AllStars Negative Control siRNA (cat.no 1027281, Qiagen). Both siCtrl and siFOXA1 at a concentration of 10 µM were delivered to cells using the lullaby siRNA transfection reagent (OZ biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: The siRNA targeting chTOG and Hec1 were ordered from Qiagen. Hec1 was depleted with a custom synthesized siRNA sequence (5’-CCCUGGGUCGUGUCAGGAA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... we mixed Lipofectamine 3000 and siRNA (Qiagen, Hs_PLCB1_4, SI00115521; Qiagen, Hs_PLCB1_6 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The non-targeting control siRNA (NTC) used was from Qiagen GeneGlobe (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... and a non-targeting siRNA (All-Star negative control, QIAGEN).
-
bioRxiv - Cancer Biology 2021Quote: ... against HNF1B compared with negative and positive control siRNA (Qiagen). 8 x 103 and 8 x 105 of VCaP cells were used in reverse transfection for 96-well plate and 6-well plate ...
-
bioRxiv - Cell Biology 2021Quote: ... We used 20 nM KDM4A FlexiTube GeneSolution siRNA (Qiagen, GS9682), 5 nM siKDM4B (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblasts were transfected with siRNA using HiperFect transfection reagent (Qiagen). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) using 9.5 μl of Oligofectamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... or 100 nM FlexiTube siRNA to ARF6 (Qiagen, Valencia, CA) for 72 hours prior to plating and then seeded at 2×104 cells/well in complete media ...
-
bioRxiv - Cell Biology 2021Quote: siRNA complexes were formed using HiPerfect transfection reagent (Qiagen, USA). The volume of siRNA for a final concentration of 15 nM per well was mixed with 6 μL of HiPerfect in 100 μL of Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with 20 nM siRNA and HiPerFect (QIAGEN), and used after 3 days.
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNA were used: All-Star control (Qiagen, SI03650318), siRNA against Arp3 (Dharmacon M-012077-01-0010) ...
-
bioRxiv - Cell Biology 2022Quote: Transient siRNA experiments were performed using HiPerfect Transfection Reagent (Qiagen, Hilden ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs were purchased as a set of four from Qiagen for myosin IIA (GS17886) ...
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with AllStars Mouse Negative Control siRNA (Qiagen) or siKras (siKRAS_234 as described by Yuan et al.59 ...
-
bioRxiv - Molecular Biology 2021Quote: Small interfering RNAs (siRNAs) were purchased from (Qiagen, Hiden, Germany) (Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Piezo1-targeting or control scrambled siRNA (siScrambled; Qiagen, Hiden, Germany) was transfected in proliferation medium ...
-
bioRxiv - Cell Biology 2020Quote: VSMCs were transfected with siRNA against PKCα (SI01965138, Qiagen, UK) using RNAiMAX (Invitrogen™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 120 nM of siRNA and 0.625% HiPerFect (cat# 301704, QIAGEN) and no antibiotics ...
-
bioRxiv - Genetics 2020Quote: ... Cells were treated with an siRNA to target TRAFD1 (Qiagen catalogue 1027416 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a Negative Control non-targeting siRNA were from Qiagen and transfected with lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 250 pM of AllStars Negative Control siRNA (Qiagen, 1027280) or CXCR4 siRNA (GUUUUCACUCCAGCUAACACA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... In RNA interference experiments we used siRNA control (1027310, Qiagen) and siRNA ZnT9 (114789 ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-targeting siRNA was purchased from Qiagen (Catalog No. – 1027281) and used as a negative reference control ...
-
bioRxiv - Cancer Biology 2022Quote: ... or recommended All Stars negative control siRNA (cat. 1027281, Qiagen); 7.5nM of PD-L1-specific miR-455-5p TSB (339194 ...
-
bioRxiv - Cell Biology 2023Quote: ... or an equivalent amount of AllStars negative control siRNA (Qiagen) were transfected into LX2 cells using Lipofectamine 3000 transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: Lyophilized siRNAs targeting S6K1 or S6K2 were obtained from Qiagen in Flexitubes® with a preference for verified siRNA sequences ...