Labshake search
Citations for Qiagen :
101 - 150 of 539 citations for GRAMD1A siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The siRNA used as control (siCTRL) was Allstars negative control siRNA (Qiagen, Cat. No. 1027281). GRASP65 and GRASP55 were downregulated with Flexitube siRNAs (GS64689 and GS26003 respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... AllStars negative control siRNA (SI03650318) and the ATG4B-specific siRNA (SI03156314) were purchased from QIAGEN.
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Neuroscience 2022Quote: The siRNAs used in this study were: All Star Negative Control siRNA (Qiagen, Cat# 1027280), human siSTAU1 ...
-
bioRxiv - Microbiology 2023Quote: ... No siRNAs were added to mock samples and 50 pmol of scrambled siRNA (SI03650318; QIAGEN) was used as a negative control ...
-
bioRxiv - Cell Biology 2021Quote: ... The siRNA used as control (siCTRL) was Allstars negative control siRNA (Qiagen, Cat No./ID: 1027280). siRNAs targeting ACTN1 were siACTN1 #5 (Hs_ACTN1_5 ...
-
bioRxiv - Immunology 2020Quote: Cancer cells were transfected with KALRN siRNA or control siRNA using Effectene Transfection Reagent (Qiagen, B00118) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... ALL STAR negative control siRNA (SI03650318) and TSG101 siRNA (SI02655184) were purchased from Qiagen (Hilden, Germany). PFDN4 siRNA (siGENOME SMART pool siRNA M-013012) ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Immunology 2023Quote: ... Transfection of siRNA was performed overnight using 6 nM for each siRNA with HiPerFect reagent (QIAGEN) according to the manufacturer’s reverse transfection protocol ...
-
bioRxiv - Microbiology 2023Quote: Specific siRNAs for the indicated target genes and the negative control siRNAs were purchased from Qiagen. The siRNAs were mixed in Lipofectamine RNAiMAX transfection reagent (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... negative control siRNA (UUCUCCGAACGUGUCACGUdTdT) (Qiagen, 1022076). A 20μM concentration of siRNA solution was used for injection.
-
bioRxiv - Molecular Biology 2019Quote: ... or all star scrambled siRNA (Qiagen) was used a control ...
-
bioRxiv - Cancer Biology 2021Quote: Individual set of two siRNAs (Qiagen) against HNF1B or ERG were tested in knockdown efficiency and compared with the siRNA negative-control (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and with siRNA using HiPerFect (Qiagen). Antibodies used are listed in Supplementary Table 1.
-
bioRxiv - Cell Biology 2021Quote: ... AllStars Negative control siRNA (Qiagen, SI03650318) was used as a negative control.
-
bioRxiv - Microbiology 2021Quote: ... AllStars™ negative-control siRNA (Qiagen) was used as an irrelevant siRNA control at the same concentrations as the gene specific siRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... we used a scrambled siRNA (Qiagen) at 10nM.
-
bioRxiv - Cell Biology 2022Quote: AllStars negative control siRNA (QIAGEN, 1027281) was used as control siRNA in knockdown experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... Yap targeting siRNA oligos (25nM; Qiagen) or control siRNA (25nM ...
-
bioRxiv - Systems Biology 2022Quote: ... AllStars Negative Control siRNA (Qiagen #1027280) or ON-TARGETplus Non-targeting siRNAs (horizon ...
-
bioRxiv - Genetics 2022Quote: ... AllStars Negative Control siRNA (Qiagen # 1027280); human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or Hs_MAN1B1 siRNA (QIAGEN, Germantown, MD) was added to 88 μL of Opti-MEM reduced-serum medium (Thermo Fisher) ...
-
bioRxiv - Microbiology 2019Quote: ... The non-targeting siRNA AllStars (Qiagen) was used as negative control ...
-
bioRxiv - Cell Biology 2019Quote: FlexiTube siRNA Mm_Prkaca_1 (SI01388331, QIAGEN, Germany) and AllStars Negative Control siRNA (QIAGEN ...
-
bioRxiv - Cell Biology 2019Quote: ... and AllStars Negative Control siRNA (QIAGEN) were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... AllStars Negative Control siRNA (Qiagen 1027281) was used as control.
-
bioRxiv - Molecular Biology 2019Quote: ... All siRNAs used were from Qiagen, and the sequence of their sense strand is the following ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_TBK1_7 FlexiTube siRNA (SI02224418, Qiagen, UK) All the siRNA were used at a final concentration of 50 nM.
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_TBK1_6 FlexiTube siRNA (SI02224411, Qiagen UK); Hs_TBK1_7 FlexiTube siRNA (SI02224418 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_TBK1_5 FlexiTube siRNA (SI00301889, Qiagen, UK); Hs_TBK1_6 FlexiTube siRNA (SI02224411 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_TBK1_1 FlexiTube siRNA (SI00100961, Qiagen, UK); Hs_TBK1_5 FlexiTube siRNA (SI00301889 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_RELA_5 FlexiTube siRNA (SI00301672, Qiagen, UK); Hs_TBK1_1 FlexiTube siRNA (SI00100961 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_PSAT1_15 FlexiTube siRNA (SI04272212, Qiagen, UK); Hs_RELA_5 FlexiTube siRNA (SI00301672 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_PSAT1_14 FlexiTube siRNA (SI04265625, Qiagen, UK); Hs_PSAT1_15 FlexiTube siRNA (SI04272212 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_PSAT1_12 FlexiTube siRNA (SI03222142, Qiagen, UK); Hs_PSAT1_14 FlexiTube siRNA (SI04265625 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_PSAT1_10 FlexiTube siRNA (SI03019709, Qiagen, UK); Hs_PSAT1_12 FlexiTube siRNA (SI03222142 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_IRF3_4 FlexiTube siRNA (SI02626526, Qiagen, UK); Hs_PSAT1_10 FlexiTube siRNA (SI03019709 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_IKBKE_9 FlexiTube siRNA (s102655324, Qiagen, UK); Hs_IRF3_4 FlexiTube siRNA (SI02626526 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_IKBKE_8 FlexiTube siRNA (S102655317, Qiagen, UK); Hs_IKBKE_9 FlexiTube siRNA (s102655324 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hs_ATF4_9 FlexiTube siRNA (SI04236337, Qiagen, UK); Hs_IKBKE_6 FlexiTube siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... AllStars Negative Control siRNA (Qiagen 1027281) was used as control ...
-
bioRxiv - Pathology 2021Quote: ... MEKK3 siRNA were purchased from QIAGEN (Hs_MAP3K3_5 ...
-
bioRxiv - Microbiology 2020Quote: ... All-Stars negative control siRNA (Qiagen) was used as a control ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Developmental Biology 2020Quote: Flexitube Gene Solutions siRNA mixtures (Qiagen) were utilized to knockdown the indicated target ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control siRNA (1027281) was from Qiagen, rat SUN1 (gene ID:360773 ...
-
bioRxiv - Molecular Biology 2021Quote: ... AllStars Negative Control siRNA (Qiagen 1027281) was used as control ...
-
bioRxiv - Cell Biology 2020Quote: ... we used a scrambled siRNA (Qiagen) at 10nM ...