Labshake search
Citations for Qiagen :
201 - 250 of 2049 citations for GDNF family receptor alpha 1 GFRA1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tagged fusion proteins were purified with a Ni-NTA column (Qiagen), and the elution fraction was incubated with TEV protease for 15-18 h at 4°C to cleave the N-terminal His-tag ...
-
bioRxiv - Microbiology 2022Quote: ... His-Hcp was purified from the soluble fraction by NTA-resin chromatography (Qiagen). Purified protein was desalted with a PD-10 desalting column (GE Healthcare ...
-
bioRxiv - Plant Biology 2022Quote: ... Target protein was recovered and purified with a His-Trap affinity column (QIAGEN) according to manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparation of his-tagged recombinant proteins was performed according to manufacturer instructions (Qiagen). Preparation of GST-tagged recombinant proteins was performed according to manufacturer instructions ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged SLFN11 (residues 349-901) was purified by Ni-NTA beads (Qiagen). All purified GST- or His-tagged proteins were dialyzed against a buffer containing 50 mM Tris-HCl and 150 nM NaCl and validated by Coomassie blue-stained SDSLJPAGE.
-
bioRxiv - Neuroscience 2024Quote: ... The His-tagged nanobodies were purified by using Ni-NTA purification column (Qiagen) followed by desalting step using disposable PD-10 desalting columns (Cytiva ...
-
bioRxiv - Bioengineering 2024Quote: ... Each His-tagged protein in media was captured with Ni-NTA resin (Qiagen) and eluted with DPBS containing 150 mM imidazole.
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 200nM siRNA/well were used for transfection using 5µl/well of Hi-Perfect (Qiagen) following manufacturer’s recommendation.
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-tagged proteins from the supernatant were incubated overnight with Ni-NTA agarose (Qiagen) at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged proteins were purified by affinity chromatography on Ni-NTA Agarose resin (Qiagen) and eluted with buffer containing 0.5 M imidazole ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated from the three HEK293 cell lines after 48 h in culture using the RNeasy Protect Mini Kit (catalog #74124, Qiagen). After reverse transcription (Super-Script II reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were transfected with plasmids (WT mGlu1, the mGlu1 mutants, or the control vector) using SuperFect transfection reagent (Qiagen) or Viafect (promega ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Approximately 5×106 HEK293 cells were used to isolate RNA with the All Prep RNA/DNA Mini Kit (Qiagen; 80204). cDNA was generated using 1μg of RNA with oligo(dT ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
Fatty acid binding proteins shape the cellular response to activation of the glucocorticoid receptorbioRxiv - Pharmacology and Toxicology 2021Quote: ... qPCR was performed using the RT2 SYBR Green Mastermix and Glucocorticoid Receptor Signalling RT2 Profiler PCR Array from Qiagen, according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... into 4 million HEK293-GP cells in 300 µl Buffer EC with 16 µl Enhancer and 60 µl Effectene Transfection Reagent (Qiagen 301425) (Morgenstern and Land ...
-
bioRxiv - Biochemistry 2020Quote: ... The His-tag protein was purified by using a column of Ni-Sepharose 4B (Qiagen), followed by gel filtration using a Superdex 75 column (G.E ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... MCP (His-HaloTag-2xMCP) was purified using its histidine tag with Ni-NTA Agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CSF3R protein was enriched by nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen 30210) and further purified by size-exclusion chromatography on a Superdex 75 10/300 GL column (Cytiva 17517401 ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Microbiology 2023Quote: ... and were probed with either horseradish peroxidase (HRP)- conjugated primary antibodies against His-tag (Qiagen) or with rabbit primary antibodies against HA-tag (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...
-
bioRxiv - Microbiology 2024Quote: ... His-tag-affinity chromatography-purifcation was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...