Labshake search
Citations for Qiagen :
51 - 100 of 370 citations for GAD65 B78 Human Monoclonal Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... For the total fractions we lysed the metabolically labeled cells directly in Qiazol (Qiagen).
-
bioRxiv - Genetics 2023Quote: ... with biotin-labeled methylation-specific primers designed with Pyromark Assay Design Software 2.0 (Qiagen). The primer sequences are shown in Supplemental Table S1 ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Biochemistry 2020Quote: ... and protein expression was analyzed by immunoblotting using monoclonal anti-RGSH4 antibodies (Qiagen) to detect ABCG5 and polyclonal anti-hABCG8 antibodies (Novus Biologicals ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse monoclonal antibody that recognizes the strep-tag epitope was purchased from Qiagen. Recombinant NifB expressed in E ...
-
bioRxiv - Cancer Biology 2020Quote: ... Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P, SCRAMBLE-MIR, miRCURY LNA U6, Qiagen) were diluted in hybridiziation buffer after a denaturation step at 90 °C and incubated on cells for 30 min (60 min tissue sections ...
-
bioRxiv - Neuroscience 2021Quote: ... Purification of C-terminal His6-tag-labeled GluN1 and GluN1ΔM4 by Ni2+-NTA agarose (Qiagen) chromatography was performed as in (Madry et al. ...
-
bioRxiv - Zoology 2019Quote: ... Labeled cRNA thus obtained was cleaned up using Qiagen RNeasy columns (Qiagen, Cat No: 74106). The concentration and amount of dye incorporated were determined using Nanodrop ...
-
bioRxiv - Neuroscience 2023Quote: ... fluorescently labeled GC particles were collected in RLT (Allprep DNA/RNA Micro Kit #80284, Qiagen) supplemented with 10% b-Mercaptoethanol.
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA from the control human TSCs as well as GATA2-KD and GATA3-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, Germantown, MD) per the manufacturer’s protocol with on-column deoxyribonuclease digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Biochemistry 2022Quote: ... an anti GAPDH monoclonal antibody (SC-47724) or an anti RGS HIS6 HRP (QIAGEN). When necessary ...
-
bioRxiv - Bioengineering 2022Quote: Genomic DNA was extracted from monoclonal cells using DNeasy Blood and Tissue kit (Qiagen) following the instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples for total or 4sU labeled RNA were immediately resuspended in Qiazol lysis reagent (Qiagen, 79306) for RNA extraction ...
-
bioRxiv - Bioengineering 2022Quote: ... Scrambled siRNA and Alexa Fluor 546 labeled siRNA (AF546-siRNA) were purchased from Qiagen (MD, USA). mRNA targeting firefly luciferase was purchased from Trilink Biotechnologies (CA ...
-
bioRxiv - Cell Biology 2019Quote: ... Cy3-labeled miR-430 was separated from unconjugated dyes using a QIAquick Nucleotide Removal Kit (QIAGEN).
-
bioRxiv - Biochemistry 2021Quote: ... The Cy3-CTP labeled cRNA sample was purified using the Qiagen RNeasy column (Qiagen, Cat # 74106). The concentration of cRNA and dye incorporation was determined using Nanodrop-1000.
-
bioRxiv - Cell Biology 2022Quote: ... Dual labeled miRCURY LNA miRNA detection probes of dre-mir-430a-3p and scramble-miR (Qiagen, catalogue no ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed overnight using a mouse monoclonal anti-StrepII antibody (Qiagen catalog number 34850) at a 1:2500-1:5000 dilution or a rabbit polyclonal antiserum raised against the PlpD C-terminal peptide NH2-EWLTRVQLGDRQELYSEFYQC-COOH at a 1:5000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... The eluted 4sU-labeled RNA and reserved total RNA were purified with the miRNeasy Micro kit (Qiagen) according to the manufacturer’s protocol with on-column DNase I treatment ...
-
bioRxiv - Biophysics 2023Quote: ... Nap1 FL was also labeled with XFD488 in 1:4 molar ratio after nickel affinity purification (Qiagen) and further purified with anion exchange and size exclusion chromatography (Cytiva) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Genomics 2021Quote: ... The fragmented and labeled DNA samples were purified from excess nucleotides using “QIAquick PCR Purification Kit” columns (QIAGEN), according to manufacturer’s recommendations.
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Genomics 2019Quote: ... 750ng of the gDNA was labeled using DLE-1 enzyme and reaction mix followed by Proteinase K digestion (Qiagen). The DNA back bone was stained after drop dialysis ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...