Labshake search
Citations for Qiagen :
1 - 50 of 815 citations for F actin uncapping protein LRRC16A CARMIL1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Molecular Biology 2024Quote: ... FITC-conjugated HSATII probes were purchased from QIAGEN and are based on the sequence used in previous publications (Hall et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... FITC-conjugated HSATII probes were purchased from QIAGEN and are based on the sequence used in previous publications (Hall et al. ...
-
bioRxiv - Immunology 2020Quote: ... β-actin (pre-designed primers from Qiagen); HPRT(Eun et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Microbiology 2024Quote: ... Mouse GAPDH or human actin mRNAs were used as a reference and detected by QuantiTect primer assay (GAPDH; QT01658692, Actin; QT01680476, Qiagen) and the qPCRBIO SyGreen mix Hi-ROX (PCR Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Actin primers were obtained from Quantitect (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... and protein expression was analyzed by immunoblotting using monoclonal anti-RGSH4 antibodies (Qiagen) to detect ABCG5 and polyclonal anti-hABCG8 antibodies (Novus Biologicals ...
-
bioRxiv - Cell Biology 2020Quote: ... Kinetochore proteins were conjugated to these beads using antibodies that recognize specific proteins or their tags: biotinylated anti-His-tag antibodies (6 µg ml−1, Qiagen), biotinylated anti-GFP antibodies (20 µg ml−1 ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Molecular Biology 2023Quote: ... 40% of the protein material of each fraction was analyzed by Western blot using an anti-his antibody (Penta-His antibody, Qiagen #34660). Detection was performed with a secondary antibody conjugated with horseradish peroxidase (Anti-Mouse IgG Peroxidase antibody ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins transferred to a nitrocellulose membrane were probed with a monoclonal anti-His6 antibody (Qiagen, Germantown, Maryland). Detection of proteins via Western blotting was performed by fluorescence detection using IR-Dye®-labeled fluorescent secondary antibodies and imaged using the Odyssey CLx Imager (LICOR Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... His-tagged proteins were detected with a mouse anti-His HRP-conjugated antibody (1:3000) from Qiagen. MBP fusion proteins were detected with a rabbit anti-MBP from NEB company 1:1000 followed by an incubation with a goat anti-rabbit HRP-conjugated (1:3000) ...
-
bioRxiv - Genetics 2020Quote: ... with beta-actin as a reference gene (QuantiFast SYBR Green PCR Kit; Qiagen) on a Roche LightCycler 480 ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Cell Biology 2021Quote: ... Genomic DNA of clones showing depletion of spartin protein by immunoblot analysis with the spartin antibody were extracted (DNeasy Blood and Tissue Kit, Qiagen), and the genomic DNA sequence surrounding the target exon of spartin was amplified by PCR (sense ...
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... FITC-negative and non-sorted fractions immediately after cell sorting using the QIAmp DNA Microbiome kit (Qiagen) and a FastPrep-24 Classic homogenizer (MP Biomedicals ...
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... For the UCP4 antibody protein samples were extracted from the paraformaldehyde fixed tissue using the Qproteome FFPE Tissue Kit (Qiagen, Germany). The tissue blocks analyzed here were taken from the anterior cingulate and occipital cortex (as described above ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: siRNA duplex for IPO9 was obtained from Ambion (id# S31299) and siRNA for the nuclear actin exporter XPO6 was obtained from Qiagen (id# SI00764099). All siRNA were transfected or co-transfected with emerin plasmids at 25 nM using X-tremeGENE HP (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sample was subsequently incubated with 80 µL strept-actin resin (Strep-Tactin Superflow Plus; QIAGEN) at room-temperature for 2 h with constant agitation on a horizontal roller mixer ...
-
bioRxiv - Genomics 2021Quote: The constructs were transfected in S2R+ cells stably expressing Actin-GAL4 using Effectene (Effectene Qiagen Kit [301425]) as per manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Protein extraction was conducted using a Qproteome Bacterial Protein Prep Kit (Qiagen)‡ ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein isolation with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Cancer Biology 2023Quote: ... Protein-protein interaction networks were built using Ingenuity Pathway Analysis (IPA) (Qiagen).
-
bioRxiv - Immunology 2024Quote: Total protein extracted from BMDM using the AllPrep RNA/Protein kit (Qiagen) was analyzed with the Osteopontin ELISA kit (Abcam ...
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Biophysics 2021Quote: ... PNGase F and the cleaved 10 × His tag were removed by passing the sample through Ni-NTA superflow resin (QIAGEN). The receptor was concentrated to 20–30 mg/ml with a 100 kDa cut-off concentrator (Millipore) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the large stocks of recombinant T/F LTR-pGL3 reporter plasmids were generated using Plasmid Maxi kit (Qiagen, Valencia, CA) for immediate use or longer storage at -80 °C.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA from polarized BMDM (M0, M1, M2) from Nf1f/f and Nf1ΔMΦ mice were extracted using RNeasy Mini kit (Qiagen; 74104). The resultant sample of total RNA (500ng-1μg ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Cell Biology 2023Quote: Cells were harvested for total protein using a Qproteome Mammalian Protein Prep Kit (Qiagen). Total protein was quantified using a PierceTM BCA Protein Assay Kit (Cat ...