Labshake search
Citations for Qiagen :
1 - 50 of 184 citations for Donkey Anti Goat IgG FITC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... then mixed with BioMag goat-rat IgG beads (Qiagen) and Ter119+ cells were depleted using a Dynal magnet (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... thymocytes were mixed with anti-rat IgG-conjugated BioMag beads (QIAgen) and incubated for 45 mins at 4°C on a MACSmix Tube Rotator (Miltenyi Biotec) ...
-
bioRxiv - Immunology 2023Quote: ... followed by magnetic depletion using goat anti-rat beads (QIAGEN). For adoptive transfer experiments ...
-
bioRxiv - Molecular Biology 2019Quote: ... FITC conjugated HSATII probes were purchased from QIAGEN and are based on the sequence used in previous publications (30 ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with goat anti-rat beads (QIAGEN, cat. no. 310107). For intracellular staining ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...
-
bioRxiv - Microbiology 2019Quote: ... Labeled probes were purified with RNeasy kit (Qiagen). Quality and quantity of RNA were controlled at each step by spectrometry (NanoDrop 1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: ... B220 (RA3-6B2) and Ly-6C/G (RB6-8C5) and anti-rat IgG-coupled magnetic beads (Qiagen) as previously described [34] ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... Labeled cRNA was purified using RNeasy Mini Spin Columns (Qiagen) and eluted in 30 μl of nuclease-free water ...
-
bioRxiv - Cancer Biology 2024Quote: ... The nick-labeled sample was treated with proteinase K (QIAGEN) at 50°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... Labeled cRNA was purified using an RNeasy Mini kit (Qiagen GmbH). The concentration and specific activity of the labeled cRNAs (pmol Cy3/μg cRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Neuroscience 2023Quote: ... labeled CPN or CThPN somata were sorted into RLT buffer (Qiagen) supplemented with 10% b-Mercaptoethanol using a customized SORP FACSAriaII (BD Instruments ...
-
bioRxiv - Biophysics 2023Quote: ... Labeled oligos were purified with QIAquick nucleotide removal kit (Qiagen; #28304) and used as reverse transcription primers.
-
bioRxiv - Microbiology 2021Quote: ... The labeled cDNAs were purified with a QIAquick PCR purification kit (Qiagen). DNA microarrays were processed and analyzed as previously described [59] ...
-
bioRxiv - Genomics 2020Quote: ... Labeled PCR product was purified with a QIAquick PCR Purification Kit (QIAGEN) and 50ng was mixed with hybridization buffer ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... Labeled DNA was purified using a spin column PCR purification kit (Qiagen) and eluted with 10 mM Tris-HCl ...
-
bioRxiv - Systems Biology 2021Quote: ... Purified labeled RNA (LRNA) and FRNA were subjected to DNase digestion (Qiagen, 79254). Total fragmented RNA and labeled RNA libraries were prepared with Ovation Universal RNA-Seq kit (NuGEN ...
-
bioRxiv - Genetics 2023Quote: ... The labeled DNA was purified using the Qiaquick PCR purification kit from Qiagen, eluted in 30 μl of water ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purification of the labeled cDNA was performed with RNeasy Mini kit (Qiagen) according to Agilent’s One-Color Gene Expression Microarray Protocol followed by the quantification using a NanoDrop2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... The labeled DNA was purified using the Qiaquick PCR purification kit from Qiagen, eluted in 30 µl of water ...
-
bioRxiv - Microbiology 2022Quote: ... FITC-negative and non-sorted fractions immediately after cell sorting using the QIAmp DNA Microbiome kit (Qiagen) and a FastPrep-24 Classic homogenizer (MP Biomedicals ...
-
bioRxiv - Biophysics 2023Quote: Fluorescently labeled 207 bp DNA fragments were purified with a PCR purification kit (Qiagen), and nucleosome reconstitution performed as described above ...
-
bioRxiv - Systems Biology 2023Quote: ... For the total fractions we lysed the metabolically labeled cells directly in Qiazol (Qiagen).
-
bioRxiv - Genetics 2023Quote: ... with biotin-labeled methylation-specific primers designed with Pyromark Assay Design Software 2.0 (Qiagen). The primer sequences are shown in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P, SCRAMBLE-MIR, miRCURY LNA U6, Qiagen) were diluted in hybridiziation buffer after a denaturation step at 90 °C and incubated on cells for 30 min (60 min tissue sections ...
-
bioRxiv - Neuroscience 2021Quote: ... Purification of C-terminal His6-tag-labeled GluN1 and GluN1ΔM4 by Ni2+-NTA agarose (Qiagen) chromatography was performed as in (Madry et al. ...
-
bioRxiv - Zoology 2019Quote: ... Labeled cRNA thus obtained was cleaned up using Qiagen RNeasy columns (Qiagen, Cat No: 74106). The concentration and amount of dye incorporated were determined using Nanodrop ...
-
bioRxiv - Neuroscience 2023Quote: ... fluorescently labeled GC particles were collected in RLT (Allprep DNA/RNA Micro Kit #80284, Qiagen) supplemented with 10% b-Mercaptoethanol.
-
bioRxiv - Molecular Biology 2019Quote: ... Samples for total or 4sU labeled RNA were immediately resuspended in Qiazol lysis reagent (Qiagen, 79306) for RNA extraction ...
-
bioRxiv - Bioengineering 2022Quote: ... Scrambled siRNA and Alexa Fluor 546 labeled siRNA (AF546-siRNA) were purchased from Qiagen (MD, USA). mRNA targeting firefly luciferase was purchased from Trilink Biotechnologies (CA ...
-
bioRxiv - Cell Biology 2019Quote: ... Cy3-labeled miR-430 was separated from unconjugated dyes using a QIAquick Nucleotide Removal Kit (QIAGEN).
-
bioRxiv - Biochemistry 2021Quote: ... The Cy3-CTP labeled cRNA sample was purified using the Qiagen RNeasy column (Qiagen, Cat # 74106). The concentration of cRNA and dye incorporation was determined using Nanodrop-1000.
-
bioRxiv - Cell Biology 2022Quote: ... Dual labeled miRCURY LNA miRNA detection probes of dre-mir-430a-3p and scramble-miR (Qiagen, catalogue no ...
-
bioRxiv - Cell Biology 2020Quote: ... The eluted 4sU-labeled RNA and reserved total RNA were purified with the miRNeasy Micro kit (Qiagen) according to the manufacturer’s protocol with on-column DNase I treatment ...
-
bioRxiv - Biophysics 2023Quote: ... Nap1 FL was also labeled with XFD488 in 1:4 molar ratio after nickel affinity purification (Qiagen) and further purified with anion exchange and size exclusion chromatography (Cytiva) ...
-
bioRxiv - Immunology 2023Quote: ... Monovalent IgG was further purified by Ni- nitrilotriacetic acid (Ni-NTA) (Qiagen) column and then size exclusion column (superdex 200 ...
-
bioRxiv - Genomics 2021Quote: ... The fragmented and labeled DNA samples were purified from excess nucleotides using “QIAquick PCR Purification Kit” columns (QIAGEN), according to manufacturer’s recommendations.
-
bioRxiv - Genomics 2019Quote: ... 750ng of the gDNA was labeled using DLE-1 enzyme and reaction mix followed by Proteinase K digestion (Qiagen). The DNA back bone was stained after drop dialysis ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed twice in PBS and DNA was labeled with propidium iodide (50 μg/ml) in presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.1%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA was labeled with propidium iodide (50 μg/ml) in the presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.01% ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (LNA oligonucleotides targeting FLAP X and FLAP Y labeled with TYE 563, Qiagen) were pre-hybridized in either 100μL of 1X SSC for conventional smiFISH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng DNA was random prime labeled (ENZO) with Cy3 (Sample DNA) or Cy5 (Input DNA) and purified on a MinElute PCR purification column (Qiagen). Labeled DNA was diluted in hybridization buffer (Agilent ...