Labshake search
Citations for Qiagen :
1 - 50 of 738 citations for Dig 6C SAH 1a b c since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 1A and B and lysed in RLT buffer (Qiagen, Germany) for RNA isolation ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Neuroscience 2023Quote: ... Syntaxin-1A was eluted from Ni-NTA-beads (Qiagen) by over-night cleavage with Prescission protease (GE healthcare ...
-
bioRxiv - Plant Biology 2024Quote: ... 3C and 6C nuclei were then sorted into 200 μl of Buffer ATL from Qiagen QIAamp DNA micro kit (#56304 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Digoxigenin (DIG)-labelled probes were denatured at 90°C for 4 min and diluted with 1 x microRNA ISH buffer (Qiagen), following protocol by Endisha & Kapoor ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: ... B220 (RA3-6B2) and Ly-6C/G (RB6-8C5) and anti-rat IgG-coupled magnetic beads (Qiagen) as previously described [34] ...
-
bioRxiv - Neuroscience 2022Quote: ... using commercially available primers for human FAAH (CpG Island 100530) (EPHS100530-1A, Qiagen). Methylation-sensitive (EPHS115450-1A ...
-
bioRxiv - Molecular Biology 2023Quote: Inhibitors (antimiRs) against miR26b-5p and miR200a/b/c-3p were purchased from Qiagen (339130 and 339160 respectively). AntimiRs in injection media (1mM Tris-HCL pH 7.5 and 0.5 mM EDTA in embryo grade water ...
-
bioRxiv - Neuroscience 2021Quote: ... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics). The protocol used is described in DOI ...
-
bioRxiv - Microbiology 2024Quote: ... Kit B (Qiagen) or the Wizard HMW DNA Extraction Kit (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... B) Proteinase K (Qiagen) diluted with PBS to 20 μg·ml-1 final concentration ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... EpiTect II DNA Methylation Enzyme Kit (335452) and EpiTect methyl II PCR system (EPMM104707-1A) for CpG methylation analysis was procured from Qiagen. [γ-32P]ATP was sourced from
-
bioRxiv - Systems Biology 2020Quote: ... was extracted from cells from the same line at different stages of conversion (Figure 1a) using the micro miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas ...
-
bioRxiv - Molecular Biology 2023Quote: ... and class II T7 promoter (transcripts starting with +1A or NAD) were produced by PCR and purified by PCR purification kit (Qiagen) by manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were obtained from whole mount larvae at the stages indicated in the legend to Fig 1A using a RNeasy Mini Kit (Qiagen, UK), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Puregene Core Kit B (Qiagen). Homozygously edited cells were identified using PCR and Sanger sequencing of gel extracted fragments (gel extraction performed using QIAquick Gel Extraction Kit from Qiagen ...
-
bioRxiv - Pathology 2024Quote: ... the stock 3’DIG-labelled probes (scrambled (included in the miRCURY LNA Control Set - Qiagen); miRNA-34a custom probe YD00618250-BEG ...
-
bioRxiv - Immunology 2020Quote: RNA from isolated fresh B cells and B cells activated with LPS/IL-4 was extracted using a RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Genomics 2020Quote: ... and GeneRead Adapter I set B (Qiagen, cat # 180986) according to Qiagen protocol with one exception ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and Negative control B Antisense LNA GapmeR (Qiagen, LG00000001) were used as controls for siRNAs and ASOs ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA was isolated using Puregene Core Kit B (Qiagen) according to the manufactureŕs instructions.
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...
-
bioRxiv - Immunology 2021Quote: B cell subsets were sorted directly into RLT buffer (Qiagen) with 1% mercaptoethanol and then snap-frozen in LN2 ...
-
bioRxiv - Immunology 2022Quote: ... B cell subsets were sorted directly into RLT buffer (Qiagen), and RNA isolated immediately ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Immunology 2022Quote: ... Antigen specific B cells were gated with CD19+/IgM-/IgD-/Ghost dye-/PE+/BV605+ and sorted in catch buffer B (Qiagen TCL Buffer + 1% beta mercaptoethanol) by one cell per well in a 96 well plate ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted using a Puregene Tissue Core Kit B (Qiagen).
-
bioRxiv - Neuroscience 2021Quote: ... target miRNAs were hybridized with 40 nM of specific DIG-labelled miRCURY probes or scramble probes diluted in hybridization buffer (Qiagen, Germantown, MD) for 1 hr at 55°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a touchdown PCR for the first 10 cycles from 72 to 60 followed by 35-40 cycles at the proper annealing temperature (Tm −2°C) and extension 68°C 30sec/Kb or 72°C 15sec/Kb and purified using a PCR purification KIT (Qiagen). Equimolar amounts of PCR products were mixed and a PCR was made with a primeSTAR GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the addition of 1% B- mercaptoethanol using the TissueLyserII (85300, Qiagen) in combination with 5mm stainless steel beads (69989 ...
-
bioRxiv - Genetics 2021Quote: ... and end-point PCRs were performed following 34 cycles (94 C 30 sec, 58 C 30 sec, 72 C 1 min) using the HotStarTaq Plus DNA polymerase (Qiagen, Canada) according to manufacturer’s protocol.
-
bioRxiv - Genomics 2020Quote: ... and B cells) using the Qiagen AllPrep RNA/DNA kit (Qiagen, CA, USA). 500ng of DNA from each sample was treated with sodium bisulfite ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... aureus genomic DNA was purified using the Puregene yeast/bacteria kit B (Qiagen). Lysostaphin ...
-
bioRxiv - Immunology 2023Quote: ... B cell lysis and RNA extraction were performed using the RNeasy Kit (Qiagen), with the quality and concentration measured using Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... Remaining B cells were lysed and mRNA was extracted using TurboCapture plates (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved B cells using the DNeasy Blood & Tissue Kit (Qiagen, cat # 69506). The Carrington Lab (National Cancer Institute ...
-
bioRxiv - Immunology 2024Quote: ... total mRNA was extracted from mouse B cells by RNeasy Micro kit (QIAGEN) and converted to cDNA by using PrimeScript RT Master Mix (Takara) ...
-
bioRxiv - Immunology 2024Quote: B cell populations were sorted with FACSAria III (Becton Dickinson) in RLT (Qiagen). The following antibody panel was used ...
-
bioRxiv - Genomics 2021Quote: ... and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Cancer Biology 2021Quote: ... splenic B cells were collected for genomic DNA isolation using the DNeasy kit (Qiagen). Sμ–Sγ3 regions were amplified using nested PCR with details and primers as previously described (63) ...
-
bioRxiv - Microbiology 2020Quote: DNA extraction was performed using the PureGene® Yeast/Bact kit B (Qiagen, Germany) following the manufacturer’s instructions for extraction of DNA from Gram-negative bacteria and eluted in molecular grade water.
-
bioRxiv - Immunology 2022Quote: Total mRNA was isolated from primary B lymphocytes using a RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA of the sorted B cells was isolated with RNeasy Mini Kit (Qiagen). The libraries for RNA-Seq were sequenced using 2×75 bases paired-end protocol on an Illumina HiSeq 3000 instrument ...
-
bioRxiv - Immunology 2023Quote: ... Cellular RNA was isolated from sorted B cell subsets with RNeasy Micro Kit (Qiagen) following the manufacturer’s instructions ...