Labshake search
Citations for Qiagen :
1 - 50 of 92 citations for Des Arg10 Kallidin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... was purchased from Qiagen (Hilden, DE). Culture medium and fetal calf serum (FCS ...
-
bioRxiv - Biochemistry 2023Quote: ... The PentaHis antibody (Qiagen, Düsseldorf, DE) against His-Tagged proteins was diluted 1:5000 in TBS buffer containing 3% BSA and the membrane was incubated overnight at 4°C followed by 2×10 min washing steps in TBST and 1×10 min in TBS buffers ...
-
bioRxiv - Cancer Biology 2021Quote: ... De-paraffinization of FFPE tumor and adjacent normal specimens was performed using QIAGEN de-paraffinization solution (QIAGEN, Valencia, CA). DNA and RNA from 19 tumor and adjacent normal samples was extracted using the AllPrep DNA/RNA FFPE Kit (QIAGEN ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloned into the pDrive vector system (Qiagen, DE), with linearised vector used as template for probe transcription ...
-
bioRxiv - Evolutionary Biology 2022Quote: Using the DNeasy Plant Mini Kit (Qiagen, Hilden, DE), we extracted DNA from disrupted leaf tissue obtained from the 3rd or 4th true leaf ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using DNeasy PowerSoil Kits (Qiagen, DE) and libraries were prepared for sequencing using the LSK108 kit (Oxford Nanopore Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... The de-husked and de-coated kernels were washed with sterile water and processed with a DNeasy Plant Mini Kit (Qiagen Inc. Valencia, CA, USA) for the fungal DNA extraction ...
-
bioRxiv - Genomics 2021Quote: ... Functional analysis of DE genes was performed with IPA (QIAGEN Inc. ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was purified via RNEasy Mini Kit (Qiagen, Hilden DE), per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... De novo assembly was achieved using CLC Genomics Workbench 10.1.1 (Qiagen). Resistome ...
-
bioRxiv - Biochemistry 2020Quote: ... De novo transcriptomes were assembled using CLC Genomics Workbench 8.5.1 (Qiagen). Filtered reads were assembled with five different word sizes (i.e ...
-
bioRxiv - Microbiology 2021Quote: ... and assembled de novo using CLC Genomics Workbench 7.0 software (Qiagen). Obtained contig sequences were analyzed using blastx algorithm by DIAMOND software (11 ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, DE), and genomic DNA was removed by treating RNase-free DNase I (Qiagen) ...
-
bioRxiv - Physiology 2020Quote: ... Dissected tissues were then transferred to 500 μl QIAzol (Qiagen, Hilden, DE) and stored at −80°C until sufficient tissue had been collected to allow extraction of a minimum of 200 ng RNA in total ...
-
bioRxiv - Genomics 2022Quote: ... DE-patterned cells were transfected by miRCURY LNA inhibitors (Qiagen, Hilden, Germany) against specific miRNAs during hindgut fate induction (FGF4/CHIR99021 cocktail) ...
-
bioRxiv - Systems Biology 2022Quote: ... Dissected tissues were then transferred to 500 μl QIAzol (Qiagen, Hilden, DE) and stored at –80°C until sufficient tissue had been collected to allow extraction of a minimum of 100 ng RNA in total ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We extracted DNA using the DNeasy Plant Mini Kit (Qiagen, Hilden, DE), sonicated (Covaris ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples underwent purification with a MinElute PCR Purification Kit (Qiagen, DE) and subsequent analysis with POWRUP SYBR MASTER MIX using a StepOnePlus Real-time PCR instrument.
-
bioRxiv - Neuroscience 2020Quote: ... Reads were assembled with CLC Genomics Workbench v12.0.3 software de novo pipeline (QIAGEN). Consensus sequence was called and manually corrected also within CLC Genomics Workbench ...
-
bioRxiv - Microbiology 2019Quote: De novo WGA was performed using CLC Genomics Workbench 7.0.4 (Qiagen, Hilden, Germany) (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... The solution was then incubated overnight with Ni-NTA agarose (Qiagen, Hilden, DE) at 4°C ...
-
bioRxiv - Physiology 2023Quote: RNA was harvested with 100 µL of QIAzol Lysis Reagent (Qiagen, Hilden, DE) per well of an MEA plate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tagmented DNA was purified using the Minelute Cleanup Kit (Qiagen, Hilden, DE, Cat #28004). DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... the samples were de-crosslinked and purified using a QIAquick PCR purification kit (Qiagen) and analysed using a qPCR.
-
bioRxiv - Microbiology 2022Quote: ... Reads were processed and de novo assembled using the CLC Genomics Workbench software (Qiagen). Assembled genomes were annotated using the RAST annotation pipeline and GeneMarkS (63 ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen, DE). Conventional PCR amplification of Gpr116 was achieved using the forward primer 5’ TCCAATTCGAGGGACCGAAG 3’ and reverse primer 5’ GTAGTTCACAACCACGCTGC 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... eluted chromatin was de-crosslinked overnight and purified with MinElute PCR Purification columns (Qiagen). After qPCR quality check for target enrichment ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Multipex PCR Kits used for MASC PCR were purchased from QIAGEN (Hilden, NRW, DE). Plasmids were extracted using Omega E.Z.N.A DNA Isolation Kit (Omega Bio-Tek ...
-
bioRxiv - Neuroscience 2021Quote: ... and the RNA was isolated using a RNeasy Plus Micro Kit (Qiagen, Düsseldorf, DE) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted by the RNeasy Mini kit from QIAGEN (74104, Hilden, DE). The library preparation and sequencing were performed by Eurofins Genomics (Tokyo ...
-
bioRxiv - Physiology 2022Quote: RNA was isolated from cells and mouse kidney using the RNeasy Mini Kit (Qiagen, DE). cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... de novo assembly of reads were performed using CLC Genomic Workbench 11.0.1 (QIAGEN, Hilden, Germany) with the default settings ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA from cell cultures was isolated using the RNeasy Mini Kit from Qiagen (Düsseldorf, DE). RNAs quality and concentration were determined using a NanoDrop ND-1000 Spectrophotometer ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from pellets using the Qiagen DNeasy UltraClean Microbial Kit (Qiagen, Hilden DE) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and a de novo assembly was performed using CLC genomics workbench 20.0.4 (QIAGEN, Hilden, Germany). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... and a de novo assembly was performed with CLC genomics workbench 20.0.4 (QIAGEN, Hilden, Germany). Finally ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA was concentrated and purified using the Gel Extraction Kit from Qiagen (Hilden, DE). Lastly ...
-
bioRxiv - Developmental Biology 2022Quote: Purification of the de-crosslinked chromatin was performed using the QIAquick PCR Purification Kit from Qiagen. The concentration was determined using the Qubit fluorometer and Quanti-iT™ PicroGreen® dsDNA Kit according to manufacturer instructions.
-
bioRxiv - Genomics 2020Quote: ... De novo genome assembly was performed using CLC Genomics Workbench 11 (QIAGEN Bioinformatics, Redwood City, CA). Depth of coverage ranges between 17X-608X (Supplemental Table S4) ...
-
bioRxiv - Genomics 2019Quote: ... Genomic sequence contigs were de novo assembled using default settings within CLC Genomics Workbench v9.5.2 (QIAGEN) with a minimum contig size threshold of 500 bp in length.
-
bioRxiv - Molecular Biology 2020Quote: ... and DNA extraction was carried out using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany, DE).
-
bioRxiv - Plant Biology 2022Quote: ... The RNA reverse-transcription was carried out using a QuantiTectReverse Transcription Kit (Qiagen N.V., Hilden, DE) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The networks and functional analyses of DE genes were generated with Ingenuity Pathway Analyser (IPA; QIAGEN Inc. ...
-
bioRxiv - Genomics 2022Quote: ... DE cells were treated with 500 nM LNA miR-182 inhibitor (Qiagen, Hilden, Germany; #4101243-101) or scrambled control (Power Negative Control A ...
-
bioRxiv - Plant Biology 2022Quote: ... The supernatant was applied to a 2-ml column of Ni-NTA-agarose (Qiagen, Hilden, DE) at a flow rate of 1 ml min−1 ...
-
bioRxiv - Genomics 2022Quote: Contigs from a de novo genomic assembly in CLC Genomics Workbench (v9; Qiagen, Redwood City, CA) were identified as mitochondrial due to sequence similarity with P ...
-
bioRxiv - Microbiology 2023Quote: ... RNAs from the eluted fraction were extracted using de miRCURY RNA Isolation Kit Cell & Plant (QIAGEN) and stored at -80 °C until cDNA library preparation ...
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Developmental Biology 2023Quote: ... Purification of the de-crosslinked chromatin was performed using the QIAquick PCR Purification Kit from Qiagen. The concentration was determined using the Qubit fluorometer and Quanti-iT™ PicroGreen® dsDNA Kit according to manufacturer instructions.
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.