Labshake search
Citations for Qiagen :
301 - 350 of 1868 citations for Dengue Virus Serotype 3 Envelope Protein Mouse Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Biophysics 2021Quote: ... PNGase F and the cleaved 10 × His tag were removed by passing the sample through Ni-NTA superflow resin (QIAGEN). The receptor was concentrated to 20–30 mg/ml with a 100 kDa cut-off concentrator (Millipore) ...
-
bioRxiv - Biophysics 2021Quote: ... NF-κB molecules were immobilized through the 6xHis-tag on the C-terminus of RelA by penta-His antibody biotin conjugate (34440, Qiagen). For DNA-bound NF-κB experiments ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Cell Biology 2021Quote: ... For PCR amplification of the V5 tag cDNA was extracted from cells and a PCR was performed using the QIAquick PCR purification kit (QIAGEN) and the following primer sequences ...
-
bioRxiv - Biophysics 2022Quote: ... Cell debris was cleared by centrifugation at 40,000 g for 45 min at 4°C and supernatant was applied to His-tag affinity purification using Ni-NTA agarose (beads or 5 ml column, Qiagen) in buffer A (50 mM TRIS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated before (T1) and after (T2) the sample-tag staining procedure using the RNeasy Mini kit (Qiagen) and RNA quality (RNA integrity number ...
-
bioRxiv - Systems Biology 2022Quote: ... The IL2Rα ectodomain was generated to include a C-terminal 6xHis tag and then purified on Nickel-NTA spin columns (Qiagen) according to manufacturer instructions.
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligated fragments were then amplified for 12-15 cycles using primers incorporating unique dual index tags with VeraSeq polymerase (Qiagen). Fragments were sequenced on an Illumina NovaSeq-6000 using paired end reads extending 150 bases.
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Microbiology 2020Quote: ... Viral nucleic acids were then isolated using the Qiagen QIAamp MinElute Virus Spin Kit without the use of AW1 buffer or carrier RNA (Qiagen, Valencia, CA, USA). Random hexamers were used to prime cDNA synthesis (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Microbiology 2019Quote: ... Short CAP was expressed and His tag purified using Ni-NTA affinity purification under native conditions using the standard manufacturer’s protocol (Qiagen, Hilden, Germany). The shortCAP recombinant protein was used to immunize female New Zealand white rabbits (Covalab ...
-
bioRxiv - Developmental Biology 2020Quote: ... mUHRF1 C-terminally tagged with GFP- and 6xHis-tag was expressed in HEK 293T cells and then purified using Qiagen Ni-NTA beads (Qiagen #30230). Recombinant mDPPA3 WT and 1-60 were purified as described above ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Clarified supernatants containing TtgR and SmtB were purified using His-tag affinity chromatography with a gravity column charged with Ni-NTA Agarose (Qiagen #30210). The eluted fractions from the FPLC (for TetR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Clarified supernatant containing mRFP1 was then purified using His-tag affinity chromatography with a gravity column charged with Ni-NTA Agarose (Qiagen #30210). The elution from the gravity column was concentrated and buffer exchanged (25 mM Tris-HCl ...
-
bioRxiv - Immunology 2023Quote: For protein production a pT350 plasmid encoding for the construct of interest with a BiP signal sequence in the N-terminal and a double strep-tag in the C-terminal region was co-transfected with a puromycin resistant plasmid (pCoPuro) (61) with effectene reagent (Qiagen, 301425) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...